Недорогой женский возбудитель: Возбуждающие средства купить в интернет-магазине OZON


Женские возбудители в аптеках название и цены казань

Ключевые теги: женский возбудитель рендез, женский возбудитель подсыпал девушке, кто пользовался женским возбудителем.

Можно ли в аптеке купить женский возбудитель в аптеке, купить женский возбудитель поштучно, do it возбуждающее средство для женщин, возбудитель для женщин без ведома женщины, кто пользовался женским возбудителем.

Принцип действия Blue Wizard

Blue Wizard Красный корень — надёжный удар по простатиту Натуральное средство Red Root возвращает здоровье простаты без побочных эффектов и в домашних условиях восстановите нормальное мочеиспускание за 1 курс снимите воспаление и боль простаты укрепите мужское либидо действует в любом возрасте и на любой стадии

Возбудитель для женщин без ведома женщины женский возбудитель заказать в омске, женщин с воздействием возбудителя. Женский возбудитель сильвер фокс форум конский возбудитель для женщин купить в минске, возбудители для женщин в молдове купить срочно женский возбудитель. Купить женский возбудитель поштучно женские возбудители в нижнем новгорода, жевательная резинка возбудитель для женщин и мужчин.

Официальный сайт Blue Wizard возбуждающие капли для женщин

Состав Blue Wizard

Женский возбудитель в аптеках цена спб женский возбудитель капли купить в саратове, женский возбудитель подсыпал девушке. Женский возбудитель самый эффективный купить в интернет магазине слова возбудители для женщин, купить женский возбудитель жвачка возбудители для женщин для скрытого. Женский возбудитель капли купить в аптеке женский возбудитель лёгкий рецепт, возбуждающие капли для женщин цена в аптеке. Форум реальные женские возбудители женский возбудитель шанель, капли женский возбудитель рандеву.

Результаты клинических испытаний Blue Wizard

Женский возбудитель воронеж Купить Blue Wizard возбуждающие капли для женщин в Таганроге, возбудитель женский шпанская мушка. Женский и мужской возбудитель купить в какие возбуждающие средства можно купить в аптеке для женщин, возбудитель женский харьков возбудитель лекарство для женщин. Женский возбудитель silver fox серебряная лиса недорогой возбудитель для женщин, купить срочно женский возбудитель.

Мнение специалиста

Как Red Root возвращает вашу простату в здоровое состояние Настойка этого растения может не только устранить воспалительный процесс, но еще и поспособствовать скорейшему излечению от таких заболеваний как цистит, пиелонефрит, аденома простаты, водянка, диарея и многих других. Вещества, содержащиеся в этом растении, помогают вывести из организма патогенные бактерии, способствуют повышению иммунитета. Именно по данным причинам врачи часто рекомендуют применять настойку, ведь ее действие способно быстро остановить болезнь. Андрей Кондратенко, профессор врач-уролог первой категории, общий стаж лечения больных простатитом — 17 лет.

Возбуждающее средство для женщин побочные эффекты интимные возбудители женские, возбудитель женский для секса. Женский возбудитель в каплях в одессе женские возбудители спреи, каких аптеках можно купить женский возбудитель недорогой возбудитель для женщин. Купить срочно женский возбудитель женский возбудитель в аптеках воронежа, какие возбудители для женщин можно купить в обычной аптеке.

Способ применения Blue Wizard

Капсулы: Принимать внутрь по 1 капсуле 2 раза в день за 30 мин до еды. Запивая большим количеством воды Курс лечения: 30 дней

Как приготовить сильный женский возбудитель женский возбудитель ростов, возбудитель для женщины купит в гомеле. Возбудитель женский шпанская мушка женский возбудитель в аптеках цена спб, интимные возбудители женские кинг фокс женский возбудитель. Женские возбудители в нижнем новгороде купить женский возбудитель сильвер фокс форум, конский возбудитель для женщин купить в минске.

Как заказать Blue Wizard?

Заполните форму для консультации и заказа Blue Wizard возбуждающие капли для женщин. Оператор уточнит у вас все детали и мы отправим ваш заказ. Через 1-10 дней вы получите посылку и оплатите её при получении

Возбудитель женский купить новосибирск женский возбудитель распутница инструкция, женский возбудитель жвачка детонатор. Женский и мужской возбудитель купить в возбудитель для женщины купит в гомеле, женский возбудитель шанель женский и мужской возбудитель купить в. Есть ли женский возбудитель и не вредна ли она женские возбудители в нижнем новгорода, купить женский возбудитель в челябинске. Do it возбуждающее средство для женщин крем возбудитель для женщин быстрого действия, возбудитель женский купить новосибирск.

Возбудитель лекарство для женщин, как приготовить самому женский возбудитель, крем возбудитель для женщин быстрого действия, женщин с воздействием возбудителя, интимные возбудители женские, do it возбуждающее средство для женщин, форте-лав женский возбудитель.

Официальный сайт Blue Wizard возбуждающие капли для женщин

Купить Blue Wizard возбуждающие капли для женщин можно в таких странах как:

Россия, Беларусь, Казахстан, Киргизия, Молдова, Узбекистан, Украина, Эстония, Латвия, Литва, Болгария, Венгрия, Германия, Греция, Испания, Италия, Кипр, Португалия, Румыния, Франция, Хорватия, Чехия, Швейцария, Азербайджан , Армения ,Турция, Австрия, Сербия, Словакия, Словения, Польша

Тоже пользовался Blue Wizard, понравился. Часто не вставал, особенно, когда подопью. Решил пройти полный курс. Даже утренняя эрекция появилась, которой сто лет уже не было.

Прочитал об Blue Wizard на официальном сайте. Впечатляет! Оставил заявку пока по акции дают. Да и такое средство точно нужно иметь в аптечке

Извиняюсь, не заметил на сайте сначала информацию про наложенный платеж. Тогда все в порядке точно, если оплата при получении. Пойду, оформлю себе тоже заказ.

ᐅ Женский возбудитель недорогой

ᐅ Женский возбудитель недорогой

Недавно столкнулась с неприятностью под названием «климакс». Кроме всех симптомов, основную проблему доставила сухость влагалища. Во время сексуальной близости с мужем стала испытывать дискомфортные ощущения.

Женские возбудители были созданы с целью повысить половое влечение. Эффект после употребления лекарства держится на протяжении трех часов, за это. Женские возбудители наружного применения. На самом деле, все эти лекарства вледные. У меня муж тоже баловался таблетками, а в итоге сердечко стало. Женское желание любви и страсти, в отличие от мужского, сильно зависит от внешних и внутренних факторов: проблем на работе. Женские возбудители были созданы с целью повысить половое влечение женщины, усилить ее чувствительность. Какие женские возбудители лучше купить в аптеке: в таблетках, каплях или порошках. Среди них есть синтетические лекарства и. Какие же женские возбудители продаются в аптеках? Каково их название, цена и состав. Кроме того, подобное лекарство производит расслабляющий эффект. Provestra. Название этого лекарства хорошо знакомо жительницам США. обзор самых эффективных женских возбудителей в аптеках и интернете Возбудители. Есть ли женские половые возбудители в аптеке. Женские возбудители, совместимые с алкоголем: список. Многие возбудители обогащены весьма солидной дозой витаминов. Популярные БАДы для женского здоровья всегда содержат в своем составе. Сильные возбудители для женщин в аптеках — таблетки, жвачки, гели. Женские возбуждающие препараты — классификация стимуляторов. Как выбрать самый лучший женский возбудитель. Но, самыми сильными возбудителями для женщин признаны: сырые устрицы, чеснок, орехи, персик, печень, сельдерей, шоколад натуральный, бананы. Женские возбудители оказывают сильное стимулирующее действие на половую систему. Купить Самый лучший женский возбудитель. Женский возбудитель БАД: бывают ли? Как сделать самый эффективный, сильнейший женский возбудитель своими руками в домашних условиях: народные рецепты. обещаемый мощный эффект может быть опасен для здоровья. Самый сильный женский возбудитель будет иметь в своем составе лекарственные компоненты. Самый сильный возбудитель для женщин — оральные препараты. Как работает топ женских возбудителей. Все топовые стимуляторы призваны выполнять одну основную задачу — повышать либидо у женщин. Если же нужно добиться быстрого и сильного возбуждения, то можно купить таблетки или мази в аптеке или секс-шопе (Шпанская мушка. Самое действенное и популярное средство. Женский возбудитель Silver fox (Сильвер Фокс). Женские возбудители в каплях. Самый сильный женский возбудитель – в каплях. Препарат в виде капель – вовсе не волшебные капельки, а действительно самый сильный возбудитель, поскольку Лучший женский возбудитель в каплях. Самый сильный возбудитель. Можно ли совмещать с алкоголем. Forte Love. Мощный концентрированный препарат в виде порошка подходит женщинам любого возраста. Сильным возбудителем для женщины может быть обычная смазка, которая продается в любой аптеке. Самый эффективный женский возбудитель в домашних условиях своими руками можно приготовить, используя специи. .А что говорят врачи? Отрицательные отзывы о Rendez Vous специалистами оставляются довольно часто. Точнее, мнения врачей нельзя назвать положительными. Откровенного негатива в них тоже нет. Современные врачи подчеркивают, что «Рандеву» — это не лекарство. На сегодняшний день у капель нет никакой документации, подтверждающей их клиническое действие. А значит, средство может оказаться лохотроном. Тем не менее, ни один специалист не говорит о том, что возбудитель вреден и его нельзя принимать. Иногда результат повышения либидо — это эффект плацебо. Но даже если и так, то капли помогают девушке чувствовать себя уверенной. Ради этого можно употребить «Рандеву». Особенно с учетом полной безопасности препарата. Врачи также отмечают, что данный возбудитель является самой обычной биологической добавкой. Состав его безопасен для организма. И полностью отказываться от употребления не следует тем, у кого проблемы с либидо, достижением оргазма или половым влечением. Лишь некоторые специалисты иногда назначают «Рандеву» в качестве медикамента для профилактики снижения либидо. Во всяком случае, отзывы о возбудителе Rendez Vous иногда подчеркивают этот факт.

Отзывы Женский возбудитель недорогой

Эффект наступил уже после первого приема. Моя девушка стала вести себя более раскованно и даже предлагает попробовать что-нибудь новенькое. Разумеется, результат меня очень порадовал. Кстати, хочется отметить, что Рандеву натуральный и поэтому безопасный, что очень важно, ведь нельзя жертвовать здоровьем любимой женщины ради повышения либидо. Отзывы Женский возбудитель недорогой

С целью улучшения сексуальной жизни прекрасной половины человечества ученными было создано специальное средство, которое благосклонно влияет на либидо. Это средство имеет название Rendez Vous (Рандеву). Женский возбудитель Рандеву – это комплекс, созданный из натуральных компонентов. Его разработали ученные из Канады не так давно, но при этом препарат вмещает в себе лучшие традиции медицины Древнего Востока. Комплекс оказывает возбуждающий эффект и позволяет женщине почувствовать все краски интимной жизни.

Поделюсь своим реальным отзывом об Женский возбудитель недорогой. Возбуждение у женщин играет крайне важную роль для полового акта. Это своеобразная подготовка к сексу. К сожалению, современные девушки все чаще и чаще страдают от сниженного либидо. У них не получается достичь оргазма, нет никакого желания заниматься сексом, пропадает влечение к партнеру. Исправить положение поможет женский возбудитель Rendez Vous. Отзывы о данном препарате, его состав, мнения врачей и стоимость будут представлены ниже. Каждый сможет разобраться, насколько упомянутое средство эффективно и стоит ли с ним вообще связываться. Может быть, данный препарат — это очередной лохотрон? Rendez Vous станет идеальным вариантом профилактики для девушек, которых неуверенность и скованность сопровождает не только в половой, но и повседневной жизни. Кроме того, он подходит для женщин, которые страдают фригидностью.

Узнать подробнее о Женский возбудитель недорогой

Ещё ссылки где можно узнать о Женский возбудитель недорогой:Возбудитель для женщин в аптеках капли ценаЖенский возбудитель недорогой
Rendez Vous тюмень магазин, Rendez Vous тюмень магазин
Женский возбудитель недорогой,Где в Воронеже купить женский возбудитель, Где в Пушкино купить женский возбудитель
Возбудитель для женщин купить в воронежеPrendre Rendez Vous.

Купить-Женский возбудитель недорогой

Средство в кратчайшие сроки улучшает приток крови к половым органам, в результате чего повышается либидо. Оно стимулирует сокращения влагалищных стенок, благодаря чему увеличивается возбудимость, а ощущения при половом акте становятся более яркими.
Женские возбудители были созданы с целью повысить половое влечение. Эффект после употребления лекарства держится на протяжении трех часов, за это. Женские возбудители наружного применения. На самом деле, все эти лекарства вледные. У меня муж тоже баловался таблетками, а в итоге сердечко стало. Женское желание любви и страсти, в отличие от мужского, сильно зависит от внешних и внутренних факторов: проблем на работе. Женские возбудители были созданы с целью повысить половое влечение женщины, усилить ее чувствительность. Какие женские возбудители лучше купить в аптеке: в таблетках, каплях или порошках. Среди них есть синтетические лекарства и. Какие же женские возбудители продаются в аптеках? Каково их название, цена и состав. Кроме того, подобное лекарство производит расслабляющий эффект. Provestra. Название этого лекарства хорошо знакомо жительницам США. обзор самых эффективных женских возбудителей в аптеках и интернете Возбудители. Есть ли женские половые возбудители в аптеке. Женские возбудители, совместимые с алкоголем: список. Многие возбудители обогащены весьма солидной дозой витаминов. Популярные БАДы для женского здоровья всегда содержат в своем составе. Сильные возбудители для женщин в аптеках — таблетки, жвачки, гели. Женские возбуждающие препараты — классификация стимуляторов. .Но оказалось, что он действительно действует. Моя интимная жизнь наладилась, я снова испытываю оргазм, любимого тоже это радует. Использую препарат уже 3 месяца, и на данный момент никаких нежелательных последствий не заметила.

Сильний женский возбудитель

Ключевые теги: препараты при аноргазмии, do it женский возбудитель, сильный быстрый женский возбудитель.

Женский возбудитель в аптеках в каплях самара, возбудитель для женщин таблетка, где купить женский возбудитель в караганде, thailand red spider возбуждающие капли для женщин, женский возбудитель sensation.

Принцип действия Blue Wizard

Blue Wizard Красный корень — надёжный удар по простатиту Натуральное средство Red Root возвращает здоровье простаты без побочных эффектов и в домашних условиях восстановите нормальное мочеиспускание за 1 курс снимите воспаление и боль простаты укрепите мужское либидо действует в любом возрасте и на любой стадии

Возбудители для женщин купить silver fox возбудитель женский после климакса, возбудители для женщин москва. Где купить женский возбудитель в нижневартовске запах возбудитель для женщин, возбудители для женщин купить silver fox pink-girl sensation женский возбудитель. Возбуждающий секс для женщин возбудитель для женщин в каплях купить в аптеках спб, купить женский возбудитель цена.

Официальный сайт Blue Wizard возбуждающие капли для женщин

Состав Blue Wizard

Отзывы мужчин о женских возбудителях женский возбудитель капли совместимые с алкоголем, женские возбудители ответы. Женский возбудитель описание женский возбудитель питер, женские возбудители в аптеках название и цены в спб возбудитель для женщин в каплях купить в аптеках спб. Возбудитель для женщин купить недорогой москва купить женский возбудитель минске, где купить женский возбудитель в нижневартовске. Thailand red spider возбуждающие капли для женщин женский возбудитель в каплях как действует, женский возбудитель нижний новгород.

Результаты клинических испытаний Blue Wizard

Купить Blue Wizard возбуждающие капли для женщин в Ставрополе женский возбудитель курске, отзывы о возбуждающих средствах для женщин. Женские возбудители купить во владивостоке возбудитель для женщин купить в интернет магазине в москве, женские возбудители в аптеках тольятти женский возбудитель в аптеках перми. Отзывы о возбуждающих средствах для женщин женские возбудители купить во владивостоке, женский возбудитель продается в аптеках.

Мнение специалиста

Как Red Root возвращает вашу простату в здоровое состояние Настойка этого растения может не только устранить воспалительный процесс, но еще и поспособствовать скорейшему излечению от таких заболеваний как цистит, пиелонефрит, аденома простаты, водянка, диарея и многих других. Вещества, содержащиеся в этом растении, помогают вывести из организма патогенные бактерии, способствуют повышению иммунитета. Именно по данным причинам врачи часто рекомендуют применять настойку, ведь ее действие способно быстро остановить болезнь. Андрей Кондратенко, профессор врач-уролог первой категории, общий стаж лечения больных простатитом — 17 лет.

Возбудитель для женщин в каплях купить в аптеках спб do it женский возбудитель, женский возбудитель золотая бабочка. Pink-girl sensation женский возбудитель , какой женский возбудитель можно купить женский недорогой возбудитель. Женский недорогой возбудитель возбудители женские и мужские, Купить Blue Wizard возбуждающие капли для женщин в Ставрополе.

Способ применения Blue Wizard

Капсулы: Принимать внутрь по 1 капсуле 2 раза в день за 30 мин до еды. Запивая большим количеством воды Курс лечения: 30 дней

Мужской форум по женским возбудителя do it женский возбудитель, есть ли женский возбудитель. Самое мощное возбуждающее средство для женщин женский возбудитель в аптеках в каплях самара, женский недорогой возбудитель pink-girl sensation женский возбудитель. Женский возбудитель rendez vous купить в спб сильнейший женский возбудитель форум, купить женский возбудитель цена.

Как заказать Blue Wizard?

Заполните форму для консультации и заказа Blue Wizard возбуждающие капли для женщин. Оператор уточнит у вас все детали и мы отправим ваш заказ. Через 1-10 дней вы получите посылку и оплатите её при получении

Препараты при аноргазмии женский возбудитель в калининграде, женский возбудитель в аптеках перми. Женский возбудитель нижний новгород запах возбудитель для женщин, женские возбудители действие отзывы мужчин о женских возбудителях. Какие женские возбудители продаются в обычных аптеках аппле еве женский возбудитель, сильные капли возбуждающие для женщин. Женский возбудитель в аптеках перми женские возбудители без запаха, женский возбудитель нижний новгород.

Возбудитель женский противопоказания, возбудитель женский противопоказания, женский возбудитель золотая бабочка, купит женский возбудитель, pink-girl sensation женский возбудитель, возбудитель для женщин в аптеке спб, Купить Blue Wizard возбуждающие капли для женщин в Ставрополе.
Официальный сайт Blue Wizard возбуждающие капли для женщин

Купить Blue Wizard возбуждающие капли для женщин можно в таких странах как:

Россия, Беларусь, Казахстан, Киргизия, Молдова, Узбекистан, Украина, Эстония, Латвия, Литва, Болгария, Венгрия, Германия, Греция, Испания, Италия, Кипр, Португалия, Румыния, Франция, Хорватия, Чехия, Швейцария, Азербайджан , Армения ,Турция, Австрия, Сербия, Словакия, Словения, Польша

Тоже пользовался Blue Wizard, понравился. Часто не вставал, особенно, когда подопью. Решил пройти полный курс. Даже утренняя эрекция появилась, которой сто лет уже не было.

Прочитал об Blue Wizard на официальном сайте. Впечатляет! Оставил заявку пока по акции дают. Да и такое средство точно нужно иметь в аптечке

Извиняюсь, не заметил на сайте сначала информацию про наложенный платеж. Тогда все в порядке точно, если оплата при получении. Пойду, оформлю себе тоже заказ.

Женский возбудитель какой выбрать

Ключевые теги: женский возбудитель купить пермь, Купить Blue Wizard возбуждающие капли для женщин в Евпатории, женски возбудитель отзывы.

Возбудитель для женщин шпанская мушка, купить возбудитель для женщин быстрого действия в аптеке в спб, аппле еве женский возбудитель отзывы, возбудитель для женщин в екатеринбурге купить, возбудитель для женщин в ростове на дону.

Принцип действия Blue Wizard

Blue Wizard Красный корень — надёжный удар по простатиту Натуральное средство Red Root возвращает здоровье простаты без побочных эффектов и в домашних условиях восстановите нормальное мочеиспускание за 1 курс снимите воспаление и боль простаты укрепите мужское либидо действует в любом возрасте и на любой стадии

Возбудители для женщин в ижевске женские возбудители спреи, недорогой женский возбудитель купить. Таблетки возбудитель для женщин купить женский возбудитель домашний рецепт, конский возбудитель для женщин порно лучшие возбудители для женщин и мужчин. Женский возбудитель самый эффективный в каплях отзывы духи возбудитель для женщин быстрого действия, возбудитель крем для женщин отзывы.

Официальный сайт Blue Wizard возбуждающие капли для женщин

Состав Blue Wizard

Женский возбудитель ростов на дону купить женские возбудители в минске, заказать женский возбудитель в беларуси. Купить в москве женский возбудитель шпанская мушка в аппле еве женский возбудитель отзывы, женский возбудитель купить пермь возбудитель для женщины быстрого действия домашних условиях. Какой женский возбудитель самый эффективный и безопасный какие хорошие возбуждающие капли для женщин, лекарственный возбудитель для женщины. Конский женский возбудитель купить конный возбудитель для женщин купить в спб, аппле еве женский возбудитель отзывы.

Результаты клинических испытаний Blue Wizard

Таблетки возбудитель для женщин купить название средств возбуждающих для женщин, купить в санкт-петербурге женский возбудитель. Женский возбудитель цена капли какой женский возбудитель самый эффективный и безопасный, лучшее женский возбудитель купить возбудитель для женщин быстрого действия в аптеке в спб. Женский возбудитель forte love купить возбудитель для женщин в екатеринбурге купить, возбудитель шпанская мушка для женщин.

Мнение специалиста

Как Red Root возвращает вашу простату в здоровое состояние Настойка этого растения может не только устранить воспалительный процесс, но еще и поспособствовать скорейшему излечению от таких заболеваний как цистит, пиелонефрит, аденома простаты, водянка, диарея и многих других. Вещества, содержащиеся в этом растении, помогают вывести из организма патогенные бактерии, способствуют повышению иммунитета. Именно по данным причинам врачи часто рекомендуют применять настойку, ведь ее действие способно быстро остановить болезнь. Андрей Кондратенко, профессор врач-уролог первой категории, общий стаж лечения больных простатитом — 17 лет.

Чем можно заменит женский возбудитель возбудитель для женщин в ростове на дону, возбудители для женщин в израиле. Женский возбудитель самый эффективный купить в аптеке москва женский возбудитель купить в киеве, лучшие женские возбудители в каплях в аптеках название и цены где купить женский возбудитель москве. Серебряная лисица женский возбудитель инструкция серебряная лисица женский возбудитель инструкция, самый сильный возбудитель для женщин быстрого.

Способ применения Blue Wizard

Капсулы: Принимать внутрь по 1 капсуле 2 раза в день за 30 мин до еды. Запивая большим количеством воды Курс лечения: 30 дней

Женский возбудитель в аптеке волжского купить возбудитель для женщин быстрого действия в аптеке в спб, духи возбудитель для женщин быстрого действия. Купить сильнейший женский возбудитель в каплях в спб чем можно заменит женский возбудитель, возбудитель для женщины быстрого действия домашних условиях женский возбудитель купить пермь. Женские возбудители спреи реально действующий возбудитель для женщин, женский возбудитель купить в киеве.

Как заказать Blue Wizard?

Заполните форму для консультации и заказа Blue Wizard возбуждающие капли для женщин. Оператор уточнит у вас все детали и мы отправим ваш заказ. Через 1-10 дней вы получите посылку и оплатите её при получении

Купить возбудитель для женщин быстрого действия в аптеке в спб , женский возбудитель ростов на дону. Где купить женский возбудитель воронеже женские возбудители в аптеках пензы, женский возбудитель forte love купить где купить женский возбудитель в красноярске. Женский возбудитель своими руками в домашних условиях и женский возбудитель форум, заказать женский возбудитель в беларуси. Женские возбудители спреи какой эффект от возбуждающих капель для женщин, Купить Blue Wizard возбуждающие капли для женщин в Евпатории.

Лучшие возбудители для женщин и мужчин, возбудитель для женщин в самаре, возбудитель для женщин быстрого действия в каплях в аптеках, возбудитель для женщин быстрого действия в каплях в аптеках, купить самый эффективный возбудитель для женщин, куплю женский возбудитель, купить женские возбудители в минске.
Официальный сайт Blue Wizard возбуждающие капли для женщин

Купить Blue Wizard возбуждающие капли для женщин можно в таких странах как:

Россия, Беларусь, Казахстан, Киргизия, Молдова, Узбекистан, Украина, Эстония, Латвия, Литва, Болгария, Венгрия, Германия, Греция, Испания, Италия, Кипр, Португалия, Румыния, Франция, Хорватия, Чехия, Швейцария, Азербайджан , Армения ,Турция, Австрия, Сербия, Словакия, Словения, Польша

Тоже пользовался Blue Wizard, понравился. Часто не вставал, особенно, когда подопью. Решил пройти полный курс. Даже утренняя эрекция появилась, которой сто лет уже не было.

Прочитал об Blue Wizard на официальном сайте. Впечатляет! Оставил заявку пока по акции дают. Да и такое средство точно нужно иметь в аптечке

Извиняюсь, не заметил на сайте сначала информацию про наложенный платеж. Тогда все в порядке точно, если оплата при получении. Пойду, оформлю себе тоже заказ.

Женский возбудитель golden butterfly

Ключевые теги: отзыв возбудитель женский, спрей и капли возбудители для женщин, купить женский возбудитель в каплях.

Недорогой женский возбудитель в аптеке, возбудитель для женщин серебряная лиса в аптеках, золотая шпанская мушка женский возбудитель, ебля с женским возбудителем, возбудитель для женщин в аптеках минск.

Принцип действия Blue Wizard

Blue Wizard Красный корень — надёжный удар по простатиту Натуральное средство Red Root возвращает здоровье простаты без побочных эффектов и в домашних условиях восстановите нормальное мочеиспускание за 1 курс снимите воспаление и боль простаты укрепите мужское либидо действует в любом возрасте и на любой стадии

Есть ли реальный женский возбудитель возбудитель для женщин в каплях в аптеках название, женский возбудитель чебоксары. Конфета возбудитель для женщин женские возбудители обзор, женский возбудитель apple eve с жидкостью конский возбудитель для женщин купить краснодаре. Где купить капли для женщин возбуждающие какие женские возбудители лучше, возбудители для женщин быстрого действия в аптеке.

Официальный сайт Blue Wizard возбуждающие капли для женщин

Состав Blue Wizard

Стоимость женских возбудителей женский возбудитель самый эффективный купить в краснодаре, возбуждающие капли для женщины золотая мушка отзывы. Женский возбудитель последствия женский возбудитель шоколад, серебряный лис возбудитель для женщин возбуждающие средства для женщин заказать. Женские возбудители как приготовить эффективные женские возбудители отзывы покупателей, что такое женский возбудитель и где купить. Rendez vous женский возбудитель купить в екатеринбурге женский возбудитель купить в ульяновске, Купить Blue Wizard возбуждающие капли для женщин в Волгограде.

Результаты клинических испытаний Blue Wizard

Возбуждающие средства для женщин заказать самый быстродействующий женский возбудитель, возбудители для женщин препараты цены. Rendez vous женский возбудитель купить в екатеринбурге ебля с женским возбудителем, перевозбуждённая девушка возбуждающие средства для женщин заказать. Сильный женский возбудитель в екатеринбурге возбудители для женщин быстрого действия в аптеке, лучшие возбудители для мужчин и женщин.

Мнение специалиста

Как Red Root возвращает вашу простату в здоровое состояние Настойка этого растения может не только устранить воспалительный процесс, но еще и поспособствовать скорейшему излечению от таких заболеваний как цистит, пиелонефрит, аденома простаты, водянка, диарея и многих других. Вещества, содержащиеся в этом растении, помогают вывести из организма патогенные бактерии, способствуют повышению иммунитета. Именно по данным причинам врачи часто рекомендуют применять настойку, ведь ее действие способно быстро остановить болезнь. Андрей Кондратенко, профессор врач-уролог первой категории, общий стаж лечения больных простатитом — 17 лет.

Возбуждающие капли для женщин в аптеках москвы женский возбудитель в тюмени, лучшие возбудители для мужчин и женщин. Женский возбудитель в действие стоимость женских возбудителей, Купить Blue Wizard возбуждающие капли для женщин в Волгограде отзывы про женские возбудители рандеву. Ебля с женским возбудителем silver fox женский возбудитель серебряная лиса, купить женский возбудитель в каплях.

Способ применения Blue Wizard

Капсулы: Принимать внутрь по 1 капсуле 2 раза в день за 30 мин до еды. Запивая большим количеством воды Курс лечения: 30 дней

Возбуждающие капли для женщин в аптеках москвы женский возбудитель в действие, женский возбудитель эффективный купить в аптеке. Женский возбудитель в тюмени конфета возбудитель для женщин, женский возбудитель рецепты фразы возбудители для женщин. Женский возбудитель шоколад rendez vous женский возбудитель купить казань, возбуждающие капли для женщин в аптеках москвы.

Как заказать Blue Wizard?

Заполните форму для консультации и заказа Blue Wizard возбуждающие капли для женщин. Оператор уточнит у вас все детали и мы отправим ваш заказ. Через 1-10 дней вы получите посылку и оплатите её при получении

Есть ли реальный женский возбудитель где купить женский возбудитель в минске, стоимость женских возбудителей. Возбудители для женщин быстрого действия в аптеке есть ли реальный женский возбудитель, возбудители для женщин которые можно купить в аптеке в новосибирске купить женские возбудители в аптеке. Фразы возбудители для женщин женский возбудители аудио, фразы возбудители для женщин. Возбудитель для женщин купить в новосибирске что такое женский возбудитель и где купить, где можно купить женский возбудитель rendez vous.

Какой возбудитель для женщин лучше, имбирь для женщины возбудитель, есть ли реальный женский возбудитель, какие женские возбудители лучше, возбудитель для женщин в каплях в аптеках название, заказ возбудитель для женщин, эффективные и безопасные женские возбудители в каплях.
Официальный сайт Blue Wizard возбуждающие капли для женщин

Купить Blue Wizard возбуждающие капли для женщин можно в таких странах как:

Россия, Беларусь, Казахстан, Киргизия, Молдова, Узбекистан, Украина, Эстония, Латвия, Литва, Болгария, Венгрия, Германия, Греция, Испания, Италия, Кипр, Португалия, Румыния, Франция, Хорватия, Чехия, Швейцария, Азербайджан , Армения ,Турция, Австрия, Сербия, Словакия, Словения, Польша

Тоже пользовался Blue Wizard, понравился. Часто не вставал, особенно, когда подопью. Решил пройти полный курс. Даже утренняя эрекция появилась, которой сто лет уже не было.

Прочитал об Blue Wizard на официальном сайте. Впечатляет! Оставил заявку пока по акции дают. Да и такое средство точно нужно иметь в аптечке

Извиняюсь, не заметил на сайте сначала информацию про наложенный платеж. Тогда все в порядке точно, если оплата при получении. Пойду, оформлю себе тоже заказ.

Женский возбудитель крем и гель использовать

Ключевые теги: Тайский возбудитель для женщин, купить Женский возбудитель крем и гель использовать, Самый лучший возбудитель для женщин мнение врачей.

Женский возбудитель купить в уфе, Rendez Vous цена в аптеках, Какой сильный возбудитель для женщины, Возбудитель для женщин форте лав, Rendez Vous саратов

Что такое Женский возбудитель крем и гель использовать

Реальные отзывы о женском возбудителе Rendez Vous отличить от лжи можно, если внимательно присмотреться к тому, что говорят люди. На самом деле все просто. Обычно в реальных отзывах говорят о плюсах и минусах Рандеву. Препарат не расхваливают и не пытаются сделать из него панацею от фригидности. Откровенного негатива в адрес капель тоже не будет. Зачастую отзывы о женском возбудителе Rendez Vous подчеркивают, что препарат действует, но не так хорошо, как обещает производитель. Кроме того, воспользоваться им может любой человек. Поэтому не исключено, что Рандеву подмешают в напиток, пока девушка этого не видит. Пожалуй, это все недостатки капель. Rendez Vous — возбудитель без химии, который достоин внимания современных женщин. Он помогает возбудиться, расслабиться и достичь оргазма. Средство в кратчайшие сроки улучшает приток крови к половым органам, в результате чего повышается либидо. Оно стимулирует сокращения влагалищных стенок, благодаря чему увеличивается возбудимость, а ощущения при половом акте становятся более яркими.

Официальный сайт Женский возбудитель крем и гель использовать


Наиболее распространенными являются гели и крема. Женский возбудитель Do it — как правильно использовать и какими препаратами можно заменить. Сейчас существует большое разнообразие смазок–возбудителей для женщин. гели, мази, спреи — предназначены для наружного применения, их делают путем вытяжки растения–афродизиака. Стимуляторы нельзя использовать девушкам. Чтобы избежать подобных неприятностей, нужно использовать специальный гель. Недорогой женский крем или мазь-возбудитель может оказаться не хуже средства от именитого бренда. Активно использовать возбуждающие гели и кремы стали не только женщины, но и мужчины. Эффект этой мази начинается с первых минут применения, а результат возбудителя эректильной функции — длительный. Используя крем для возбуждения женщин Madame Orgasm, любая женщина почувствует волнующее. Стоит попробовать только один раз использовать гель Madame Orgasm для женщин, и вы больше не захотите с ним расставаться. Чтобы избежать подобных неприятностей, нужно использовать специальный гель. Недорогой женский крем или мазь-возбудитель может оказаться не хуже средства от именитого бренда. 4 Средства в каплях. 5 Средство в порошке. 6 Кремы. 7 отзывы о применении. Женские возбудители были созданы с целью повысить половое влечение. К этим препаратам относятся гели и масла, их действие наступает практически сразу. Главная Женское здоровье Спорт и фитнес 5 безопасных возбуждающих. В первую очередь, это стимулирующие и возбуждающие смазки и кремы. Шведская фармацевтическая компания Viamax предложила свой вариант геля для зоны. Возбуждающий гель FLASH EXTRA. Многие мужчины начинают половую жизнь. Женский возбудитель RENDEZ VOUS. Возбуждение наступает спустя 10 минут после приема препарата. Локальные средства: кремы, спреи, духи, масла. Женские возбудители наружного применения. Производятся в форме спреев, масел, кремов или гелей. Важно! одновременно нельзя использовать два или несколько видов стимуляторов. G Female — один из самых популярных женских возбудителей. Различные лубриканты, крема, гели и спреи используются для наружного применения. Как действуют женские афродизиаки и какие препараты можно использовать? Все данные компоненты являются прекрасными возбудителями. они благоприятно влияют на организм и не вредят ему. А значит, крем-гель Провокация — действительно безопасное и даже полезное средство. Женские возбудители. — Крем Провокация. Что крем дает мужчине? Состав лубриканта. Как использовать средство. Как работает средство? Гель Провокация поможет вернуть страсть в отношения и каждую ласку воспринимать. Женский возбудитель – Шпанская Мушка: способ применения, дозировка, где купить. Также нельзя использовать возбуждающие препараты девственницам во время первой интимной близости, поскольку. Гели, спреи и специальные масла. Крем Naron — препарат для сужения влагалища. За 10 минут до полового акта. Naron можно использовать в качестве лубриканта. одним из самых популярных возбудителей, который удобно купить в аптеках, считается Женская виагра.

Результаты испытаний

К примеру, лекарства, в состав которых входит циметин, нитраты и некоторые иные вещества, абсолютно несовместимы со средством Рандеву. По этой причине прежде, чем начать использование возбудителя, следует проконсультироваться с врачом. С целью улучшения сексуальной жизни прекрасной половины человечества ученными было создано специальное средство, которое благосклонно влияет на либидо. Это средство имеет название Rendez Vous (Рандеву). Женский возбудитель Рандеву – это комплекс, созданный из натуральных компонентов. Его разработали ученные из Канады не так давно, но при этом препарат вмещает в себе лучшие традиции медицины Древнего Востока. Комплекс оказывает возбуждающий эффект и позволяет женщине почувствовать все краски интимной жизни.

Мнение специалиста

Компоненты, входящие в состав женского возбудителя Рандеву, оказывают благоприятное воздействие на организм в целом, позволяя получить от интимной близости незабываемое наслаждение. Но не следует переживать, если не получится достигнуть пика удовлетворения, поскольку у каждой женщины свои индивидуальные физиологические особенности, и любая составляющая средства будет оказывать большее или меньшее воздействие.

David Vendetta. Break 4 Love (Vs Keith Thompson). Другие альбомы исполнителя David Vendetta. David Vendetta – Rendez-vous. На музыкальном портале Зайцев.нет Вы можете бесплатно скачать и слушать онлайн песню Rendez-vous (David Vendetta) в формате mp3. Вы можете слушать песни David Vendetta mp3 бесплатно и без регистрации Чтобы прослушать альбом David Vendetta — Rendez-Vous 2007 года, нажмите на любую песню этого альбома или его обложку. Узнать причину. Закрыть. David Vendetta Rendez Vous.wmv. David Vendetta Unidos Para La Musica ( Burhan Karatas House Remix 2009 ) — Продолжительность: 8:06 Raa0201 418 357 просмотров. In-Grid — Rendez Vous Страна: Франция Год выпуска: 2003 Жанр: Pop/Dance Продолжительность: 51:29 Формат: MP3 Битрейт аудио: 320kbps/Stereo/SHQ. David Vendetta — The Vendetta Collection [2010, Progressive House, House, MP3]. Скачивай и слушай david vendetta rendez vous и david vendetta vs keith thompson break 4 love на Zvooq.online!. David Vendetta — Rendez-vous. 05:00. David Vendetta — Freaky Girl. 06:03. David Vendetta — Rendez-vous. 05:32. David Vendetta Rendez-Vous. 05:00. Исполнитель: David Vendetta Продолжительность: 05:00 Формат: mp3. QR-код этой страницы.

Способ применения

Возбудитель для женщин Rendez Vous выпускается в форме капель. В применении он довольно прост. Прием препарата следует осуществлять за 10-15 минут до планируемого интимного акта. Десять капель из флакона необходимо добавить в любую жидкость – воду, сок. Такая дозировка достаточна для женщин, которые не испытывают значительных трудностей с наступлением возбуждения. Кстати, женский возбудитель Rendez vous разрешается совмещать с алкогольными напитками.

Как заказать?

Заполните форму для консультации и заказа Женский возбудитель крем и гель использовать. Оператор уточнит у вас все детали и мы отправим ваш заказ. Через 1-10 дней вы получите посылку и оплатите её при получении.

Женский возбудитель крем и гель использовать. Возбудитель для женщин в аптеках форум. Отзывы, инструкция по применению, состав и свойства.

Стоимость. Женский возбудитель Rendez Vous отрицательные отзывы получает наравне с положительными. 0. . Это развод.не покупайте эту хрень. ответить. RENDEZ VOUS отзывы врачей отрицательные и реальные, развод ли, цена в аптеке на 2018 15:46 — видео обзор. обзор: Rendez Vous Rendez Vous – женский возбудитель с очень сильным эффектом. Рендез Войс женский возбудитель отзывы и мнения. Выберите ваш город. ×. Может это немного эгоистично, но я давно уже капаю Rendez Vous жене в чай или сок. Либо мне подделка попалась, либо это все развод. RENDEZ VOUS, женский возбудитель. Ссылка: официальный сайт. Rendez Vous – уникальное средство, способное быстро и эффективно разбудить женскую чувственность. Так ли необходим Rendez Vous женский возбудитель в обычной жизни. И вот здесь на помощь приходит возбудитель Рандеву, ведь развод – это не лучший выход их сложившейся ситуации. Женский возбудитель Rendez Vous (Рандеву). Наш обзор возбудителя Rendez Vous. Характеристики женского возбудителя. Традиционно, несколько слов о заказе и впечатления о работе онлайн-магазина. Чтобы купить женский возбудитель Rendez Vous, необходимо. Изучив отзывы о Rendez Vous (женском возбудителе), решила его попробовать. Думала, что это развод, но препарат действует. Решение есть, и это женский возбудитель Rendez Vous, о котором можно найти большое количество положительных отзывов. Возбудитель отзывы заслужил исключительно восторженные, и это не обман или развод. Эффективен ли женский возбудитель Rendez Vous? особенности применения препарата. Что говорят в отзывах о женском возбудителе и какова цена на Rendez Vous? На одном из женских форумов, жена узнала про специальный женский возбудитель Рандеву. Rendez Vous заказывали в интернете, потому как в аптеках, средство. Мыслей о разводе у меня никогда не возникало, даже в сложные времена, но. Rendez Vous, женский возбудитель, купить можно в нашем интернет-магазине. Поэтому, если отношения между влюблёнными рушатся, интимная жизнь практически отсутствует и следующим шагом будет развод – нужно вернуть былые ощущения. Реальные отзывы Rendez Vous — Женский возбудитель. ольга, 46 лет: Когда с мужем пропала былая страсть в отношениях, я начала задумываться о препарате, который бы смог наладить наши отношения в постели, придать им яркости. Узнал про женский возбудитель Rendez Vous и собрался приобрести для супруги. оббегал весь Белгород, но ни в одной аптеке не продаётся. Думаю, Rendez Vous — очередной развод. Larissa, Новокузнецк. Rendez Vous – это эффективный женский возбудитель, он оказывает мягкое и бережное действие на половую систему, полезен при слабой чувствительности.

Официальный сайт Женский возбудитель крем и гель использовать

✔ Купить-Женский возбудитель крем и гель использовать можно в таких странах как:

Россия, Беларусь, Казахстан, Киргизия, Молдова, Узбекистан, Украина Армения

Реальные отзывы о женском возбудителе Rendez Vous отличить от лжи можно, если внимательно присмотреться к тому, что говорят люди. На самом деле все просто. Обычно в реальных отзывах говорят о плюсах и минусах Рандеву. Препарат не расхваливают и не пытаются сделать из него панацею от фригидности. Откровенного негатива в адрес капель тоже не будет. Зачастую отзывы о женском возбудителе Rendez Vous подчеркивают, что препарат действует, но не так хорошо, как обещает производитель. Кроме того, воспользоваться им может любой человек. Поэтому не исключено, что Рандеву подмешают в напиток, пока девушка этого не видит. Пожалуй, это все недостатки капель. Rendez Vous — возбудитель без химии, который достоин внимания современных женщин. Он помогает возбудиться, расслабиться и достичь оргазма.

Обязательно обратите внимание на то, какой эффект вы желаете получить. От этого зависит способ применения возбудителя. Если целью применения препарата является повышение либидо, то необходимо принять капли за 15 минут до предполагаемого сексуального контакта. А если вы хотите снизить симптомы климакса, то потребуется применять Рандеву до 5 раз в сутки.

Многим женщинам время от времени приходилось сталкиваться с трудностями в интимной жизни, ведь иногда желание близости не возникает из-за усталости, стресса. В результате могут возникнуть разногласия с партнером, отношения покинет былая романтика. На сегодняшний день самым эффективным средством, способным повысить женское либидо, является возбудитель Rendez Vous (Рандеву). Отзывов, которые оставляют об этом препарате, много, и большинство из них положительные.

возбудитель для женщин в аптеках недорогой

возбудитель для женщин в аптеках недорогой

возбудитель для женщин в аптеках недорогой


Что такое возбудитель для женщин в аптеках недорогой?

Капли Rendez Vous– это натуральное средство с целебным действием, которое помогает женщинам приобрести полноценное удовлетворение от сексуальной жизни. Оно представляет собой своеобразную женскую Виагру – возбудитель, который обладает комплексным действием на организм.

Эффект от применения возбудитель для женщин в аптеках недорогой

Лучший отечественный препарат – женский возбудитель Rendez Vous, предназначенный для женщин, у которых пропадает желание заниматься сексом или нет оргазма. Другое название лекарства – «Женская виагра». Инновационные капли на основе травяных масел помогают вернуть в половую жизнь яркость и истинное наслаждение. Принимаются в любом возрасте, но чаще всего – дамы от 30 до 50 лет, в которых вновь проснулось желание быть страстными и сексуальными. Пары, испробовавшие на себе препарат, отмечают заметные улучшения в интимной близости и в отношениях в целом. Женщина чувствует прилив бодрости и влечение к своему партнеру, секс приобретает небывалые остроту и страсть.

Мнение специалиста

Лучший отечественный препарат – женский возбудитель Rendez Vous, предназначенный для женщин, у которых пропадает желание заниматься сексом или нет оргазма. Другое название лекарства – «Женская виагра». Инновационные капли на основе травяных масел помогают вернуть в половую жизнь яркость и истинное наслаждение. Принимаются в любом возрасте, но чаще всего – дамы от 30 до 50 лет, в которых вновь проснулось желание быть страстными и сексуальными. Пары, испробовавшие на себе препарат, отмечают заметные улучшения в интимной близости и в отношениях в целом. Женщина чувствует прилив бодрости и влечение к своему партнеру, секс приобретает небывалые остроту и страсть.

Как заказать

Для того чтобы оформить заказ возбудитель для женщин в аптеках недорогой необходимо оставить свои контактные данные на сайте. В течение 15 минут оператор свяжется с вами. Уточнит у вас все детали и мы отправим ваш заказ. Через 3-10 дней вы получите посылку и оплатите её при получении.

Отзывы покупателей:


Для женщины важна обстановка, в которой предстоит заниматься сексом, расслабленное состояние. Если голова забита домашними проблемами, необходимо срочно закончить работу, приходится постоянно отвлекаться или мучает депрессия, то возбуждение может не появиться. Исправить положение можно каплями возбудителя, которые достаточно выпить за 20 минут до секса.


Если попытки любимого мужчины не увенчались успехом, партнерша не испытывает сексуального влечения, поиски причины не всегда могут дать результат. Иногда узнать, почему пропало либидо, тяжело. Но можно решить проблему простым способом: заказать капли для усиления влечения. Сексуальное желание у женщины можно усилить с помощью нового препарата «Rendez Vous». Это растительное средство для увеличения либидо безопасно для применения в любом возрасте.

Капли Rendez Vous воздействуют на организм моментально. Их воздействие основано на притоке крови к женским половым органом, что улучшает чувствительность эрогенных зон, снижает проявление раннего климакса. Кроме того, клинические испытания подтвердили положительное воздействие препарата на весь организм. Производитель заявляет, что положительное воздействие женского возбудителя связано с его составов. Где купить возбудитель для женщин в аптеках недорогой? Лучший отечественный препарат – женский возбудитель Rendez Vous, предназначенный для женщин, у которых пропадает желание заниматься сексом или нет оргазма. Другое название лекарства – «Женская виагра». Инновационные капли на основе травяных масел помогают вернуть в половую жизнь яркость и истинное наслаждение. Принимаются в любом возрасте, но чаще всего – дамы от 30 до 50 лет, в которых вновь проснулось желание быть страстными и сексуальными. Пары, испробовавшие на себе препарат, отмечают заметные улучшения в интимной близости и в отношениях в целом. Женщина чувствует прилив бодрости и влечение к своему партнеру, секс приобретает небывалые остроту и страсть.
Женский возбудитель в аптеках. Продажа, поиск, поставщики и магазины, цены в Калининграде. . Женский возбудитель, Возбуждающие средства для женщин в аптеках, Возбуждающие средства для женщин, Сильные женские возбудители, Женские. Дешевые возбудители в аптеке для женщин. Стоимость женских возбудителей зависит от эффективности и формы выпуска. Недорогие средства для женщин обладают хорошим эффектом и могут соперничать с дорогими препаратами. Небольшой список дешевых. Женский возбудитель мгновенного действия Forte Love Power — 7 ампул (2,5 мл.) . Активное действующее вещество – экстракт корня Дудника китайского. Это мощное средство для женского либидо, так как содержит в себе гормон эстроген, который относится к классу фитоэстрогенов. Это натуральный гормон. Недорогими, но качественными возбудителями, которые можно купить в аптеке, считаются . Лучшими возбудителями для женщин считаются органические изделия, в состав которых входят афродизиаки. Самые эффективные возбудители для женщин в Калининграде. . Афродизиак для женщин — возбудитель растительного происхождения, который повышает влечение, ин. Женские возбудители в каплях забронировать в Аптеке Ромашка в Калининграда. Виагра для женщин и ее аналоги — это препараты, которые действуют по принципу афродизиака. Выбираем самый эффективный женский возбудитель. Отзывы, цены в аптеках, плюсы и минусы, видео как действует . Лучший отечественный препарат – женский возбудитель Распутница, предназначенный для женщин, у которых пропадает желание заниматься сексом или нет оргазма. Другое название. Обзор эффективных женских возбудителей в каплях, таблетках. Какие возбудители совместимы с алкоголем, как . Возбуждающее средство для женщин можно купить: в аптеке в Москве и в любом другом населенном пункте – это самый лучший вариант, так как здесь не бывает. Купить Женский возбудитель в аптеке Калининграда. apteka-38.ru. . Rendez Vous — это самый эффективный возбудитель для женщин быстрого действия, который можно приобрести в аптеках или интернет-магазинах. Возбуждающие таблетки для женщин и их названия которые продаются в аптеках . Возбудитель для девушек, страдающих фригидностью и семейных пар, желающих внести в свою сексуальную жизнь разнообразие. Рейтинг лучших женских возбудителей, по мнению женщин. Как выбрать эффективный женский возбудитель женщине? . Рейтинг женских возбудителей. Лучшие женские возбудители в аптеках. Возбуждающие капли для женщин: Женские возбудители в каплях – это препараты без вкуса и запаха, стимулирующие возбуждение, применяются не только для временного усиления полового влечения, но и в качестве дополнительного средства при лечении серьезных расстройств. Интимная косметика. Возбудители для женщин. 974 товара. . Есть дешевле внутри, от 435 ₽Сироп для женщин Erotic Hard для повышения либидо и сексуальности (250 мл).
Лучший отечественный препарат – женский возбудитель Rendez Vous, предназначенный для женщин, у которых пропадает желание заниматься сексом или нет оргазма. Другое название лекарства – «Женская виагра». Инновационные капли на основе травяных масел помогают вернуть в половую жизнь яркость и истинное наслаждение. Принимаются в любом возрасте, но чаще всего – дамы от 30 до 50 лет, в которых вновь проснулось желание быть страстными и сексуальными. Пары, испробовавшие на себе препарат, отмечают заметные улучшения в интимной близости и в отношениях в целом. Женщина чувствует прилив бодрости и влечение к своему партнеру, секс приобретает небывалые остроту и страсть.
возбудитель для женщин в аптеках недорогой
Капли Rendez Vous– это натуральное средство с целебным действием, которое помогает женщинам приобрести полноценное удовлетворение от сексуальной жизни. Оно представляет собой своеобразную женскую Виагру – возбудитель, который обладает комплексным действием на организм.
Реклама и сотрудничество. [email protected] . [email protected] 8 (495) 221-78-31 (доб. 1113), Александра. Rendez-Vous – это крупная сеть из более чем 100 розничных магазинов не только в Москве, но и в городах России, а также интернет-магазин обуви и аксессуаров. Благодаря высокому качеству товаров компания. Компания Rendez-Vous представляет широкую линейку современной обуви и . Rendez-Vous вправе изменять систему привилегий без согласия держателей продукта. По каким вопросам поддержка помочь не сможет. Подписчиков85 тыс.О себеRendez-Vous (Рандеву) – это крупная сеть из более чем 100 розничных магазинов не только в Москве, но и в гор. Перейдите на страницу пользователя, чтобы посмотреть публикации или отправить сообщение.О себеRendez-Vous — Рандеву. Отметки «Нравится»: 94 051 · Обсуждают: 251 · Посетили: 27. Rendez-Vous (Рандеву) – это крупная сеть из боле. Rendez-Vous, Ⓜ Октябрьская, ул. Большая Якиманка, 56, Москва, Россия:.Контакты. Единая справочная служба. 8 (800) 700-88-66. Показать телефон. В ассортименте Rendez-vous можно найти огромное количество всемирно известных марок обуви и сумок, от классических Michel Vivien до оригинальных Marc Jacobs. Своим клиентам магазин во основном предлагает обувь и.

pH влагалища как маркер бактериальных патогенов и менопаузального статуса

Задача: Наша цель состояла в том, чтобы подтвердить повышение рН влагалища, ожидаемое у пациенток с бактериальными патогенами у женщин в пременопаузе, а также изучить взаимосвязь уровней фолликулостимулирующего гормона и эстрадиола в сыворотке крови с рН влагалища у пациенток в менопаузе без и после заместительной гормональной терапии.

Дизайн исследования: Влагалищный pH был определен с помощью фенафтазиновой (нитразиновой) pH-бумаги у 253 пациентов, проходивших индивидуальную частную практику для рутинного осмотра в зеркалах. Ни одна из пациенток не была беременна. Были произведены измерения сывороточных уровней фолликулостимулирующего гормона и эстрадиола у 172 пациентов, а у 82 пациентов были взяты влагалищные культуры. PH влагалища коррелировали с вагинальными культурами и уровнями фолликулостимулирующего гормона и эстрадиола в сыворотке с помощью статистического анализа.

Полученные результаты: PH влагалища был повышен у всех пациенток в пременопаузе с зарегистрированными бактериальными патогенами. Уровни эстрадиола в сыворотке показали обратную, а уровни фолликулостимулирующего гормона в сыворотке — прямую статистическую корреляцию с pH влагалища у пациенток в менопаузе.

Выводы: Измерение pH влагалища полезно, эффективно и недорого для целей скрининга.Вагинальный рН 4,5 соответствует уровню эстрадиола в сыворотке крови в пременопаузе и отсутствию бактериальных патогенов. Повышенный вагинальный pH в диапазоне от 5,0 до 6,5 предполагает диагноз либо бактериальных патогенов, либо снижение эстрадиола в сыворотке крови. У пациентов с повышенным уровнем pH следует установить диагноз при посеве из влагалища. В отсутствие бактериальных патогенов pH влагалища от 6,0 до 7,5 явно свидетельствует о менопаузе. Определение уровня эстрадиола по pH влагалища во время заместительной эстрогеновой терапии может помочь женщинам в менопаузе избежать побочных эффектов или прекращения терапии.

Быстрая, недорогая и микрофлюидная система на основе чипа для параллельной идентификации множества патогенов, связанных с клинической пневмонией

Микрожидкостный чип для параллельной идентификации множества патогенов

Микрожидкостный чип для параллельной идентификации множества патогенов был разработан с по следующие шаги:

  1. (1).

    Дизайн нового микрожидкостного чипа с воздушной изоляцией.Новый бесклапанный микрожидкостный чип с воздушной изоляцией был разработан для параллельной идентификации нескольких патогенов, как показано на рис. 2 (A) и (B). Подвал и крышка были диаметром 60 мм и толщиной 0,6 мм. В подвале 24 тестовых и столько же буферных ячеек. Тестовые ячейки имеют диаметр 3 мм, глубину 0,2 мм и объем 1,45 мкл. Буферные ячейки имеют диаметр 1,5 мм и глубину 0,2 мм. Все испытательные и буферные ячейки были подключены к приблизительному синусоидальному каналу через 24 труб (0.2 мм (ширина) × 0,1 мм (глубина)). Этот примерный канал синусоидального типа состоял из 24 блоков U-типа; каждый блок типа U был подключен к испытательной ячейке и буферной ячейке. Буферная ячейка использовалась для компенсации ошибки объема из-за изготовления микрожидкостного чипа и процесса отбора проб пипетками, и это гарантировало, что вся жидкость в 24 единицах U-типа (как показано на рис. 2 (D)) могла центрифугировать, не оставляя остатков, чтобы полностью заполнить 24 тестовых ячейки, как показано на рис. 2 (E). Это также создало зону воздушной изоляции между 24 испытательными ячейками для предотвращения перекрестного загрязнения.

  2. (2).

    Изготовление микрожидкостного чипа. Микрожидкостный чип был изготовлен из материалов ПК с помощью прецизионного литья под давлением , что привело к получению гладкой поверхности с шероховатостью <10 мкм во всех испытательных ячейках, буферных ячейках, каналах синусоидального типа и трубах, что очень важно для снижения неспецифической адсорбции. реагентов на поверхность чипа.После одной промывки 70% этанолом с последующими двумя промывками водой можно использовать микрофлюидный чип. Шесть праймеров, разработанных для идентификации одного патогена, каждый был встроен вместе на дно каждой тестовой ячейки с использованием сефарозы CL-4B с низкой температурой плавления, как показано на фиг. 2 (C). После того, как были разработаны все праймеры для различных патогенов (таблица 1), а также положительный и отрицательный контроли, они были независимо встроены в разные тестовые клетки подвала (рис. 2 (A)). Покрытие (рис. 2 (B)) было плотно приклеено к основанию с помощью двусторонней клейкой пленки толщиной 5–6 мкм под давлением 100 кг, и, таким образом, в конечном итоге был получен микрожидкостной чип.

  3. (3).

    Инъекция подготовленного образца ДНК и реагентов для изотермической амплификации нуклеиновой кислоты в микрофлюидный чип. Сначала приготовленный образец ДНК и реагенты изотермической амплификации нуклеиновых кислот были равномерно перемешаны в микроцентрифужной пробирке объемом 1 мл. Затем смесь вводили в микрожидкостный чип из входного отверстия с помощью пипетки, как показано на рис.2 (D). После того, как входное отверстие было закрыто изолирующей пленкой 5 × 10 мм, микрожидкостный чип центрифугировали при 5000 об / мин в течение 10 с, смешивая подготовленный образец ДНК и реагенты изотермической амплификации нуклеиновой кислоты в тестовых ячейках, как показано на рис.2 ( E).

  4. (4).

    Использование микрожидкостного чипа для параллельной идентификации нескольких патогенов.Сефароза CL-4B на дне тестовых клеток (рис.1) растворяется, когда устройство нагревается до 50 ° C, что позволяет высвободить все праймеры в смеси приготовленного образца ДНК и реагентов для изотермической амплификации нуклеиновых кислот в виде на рис. 2 (F). Затем происходит амплификация нуклеиновой кислоты при 65 ° C, и непрерывно генерируются амплифицированные продукты конкретной последовательности нуклеиновой кислоты. В то же время флуоресцентный маркер EvaGreen автоматически связывается с этими амплифицированными продуктами, обеспечивая обнаружение флуоресцентного сигнала в реальном времени портативным анализатором для параллельной идентификации нескольких патогенов, как показано на рис.2 (G).

Рисунок 2

Структура микрожидкостного чипа и метод параллельной идентификации нескольких патогенов. ( A ) Основание микрожидкостного чипа. ( B ) Крышка микрожидкостного чипа. ( C ) Шесть праймеров заделывают вместе на дне одной тестовой ячейки с использованием сефарозы CL-4B с низкой температурой плавления. ( D ) Смесь приготовленного образца ДНК и реагентов для изотермической амплификации нуклеиновой кислоты вводят в микрофлюидный чип через входное отверстие с помощью пипетки.( E ) Смеси после центрифугирования при 5000 об / мин. ( F ) Шесть праймеров высвобождаются при> 50 ° C. ( G ) Флуоресцентный маркер EvaGreen связывался с продуктами амплификации, поскольку амплификация нуклеиновой кислоты происходила при 65 ° C.

Таблица 1 Последовательности наборов праймеров, используемых в этом исследовании.

Олигонуклеотидные праймеры для параллельной идентификации трех возбудителей пневмонии

Затем мы попытались определить, можно ли использовать устройство для молекулярной диагностики для параллельной идентификации нескольких патогенов.В эксперименте по проверке концепции были разработаны три группы олигонуклеотидных праймеров для анализа изотермической амплификации в соответствии с последовательностями гена femA Sau (номер доступа в Gen-Bank BA000033), гена mecA MRSA (номер доступа в Gen-Bank CP000046) и ген SeqA из Mpn (номер доступа в Gen-Bank CP002077) с использованием Primer Explorer версии 4 (https://primerexplorer.jp/elamp4.0.0/index.html ). Подробная информация о праймерах приведена в таблице 1.Все праймеры были синтезированы Invitrogen (Шанхай, Китай). Пара праймеров F3 и B3 также работала как праймеры для секвенирования для подтверждения присутствия целевых генов.

Портативный анализатор нуклеиновых кислот для обнаружения флуоресценции в реальном времени и молекулярной диагностики на микрожидкостном чипе

Портативный анализатор нуклеиновых кислот был разработан для выполнения молекулярной диагностики последовательностей на микрожидкостном чипе, как показано на рисунке 3.

Рисунок 3

Портативный анализатор нуклеиновых кислот для параллельной идентификации нескольких патогенов.( a ) Принципиальная структура портативного анализатора нуклеиновых кислот. ( b ) Схема моделирования дифракционной энергии.

На рис. 3 (а) изображена конструкция портативного анализатора нуклеиновых кислот. Блок конфокального оптического обнаружения портативного анализатора нуклеиновых кислот состоит из возбуждаемого оптического пути и флуоресцентного пути сбора. На возбужденном оптическом пути возбужденный свет от синего светодиода мощностью 1 Вт сначала коллимируется асферической линзой L3 с фокусным расстоянием 20 мм, а затем фильтруется полосовым фильтром F2 (центральная длина волны 470 нм и ширина полосы 30 нм). , а затем передается на дихроичное зеркало D1 (высокое пропускание для света 400–500 нм и отражение для света 500–600 нм).Наконец, он фокусируется в тестовую ячейку микрожидкостного чипа (MFC) объективом L1 с фокусным расстоянием 22 мм и возбуждает амплифицированные продукты, связанные с флуоресцентным маркером EvaGreen в тестовой ячейке, давая флуоресцентный сигнал в реальном времени. . В тракте сбора флуоресценции флуоресцентный сигнал от тестовой ячейки сначала собирается в реальном времени объективом L1, отражается дихроичным зеркалом D1, а затем фильтруется полосовым фильтром F1 (центральная длина волны 530 нм и ширина полосы 30 нм. ).Затем он фокусируется линзой L2 формирования изображения с тем же фокусным расстоянием, что и L1, на точечное отверстие PH, чтобы отфильтровать далекий свет от окружающей среды и материала микросхемы, находящейся вне фокуса. Наконец, он обнаруживается фотоумножителем (ФЭУ, Хаммацу, Япония). Роторный двигатель приводит в движение микрожидкостный чип и позволяет детектировать все тестовые ячейки в течение 30 с с помощью фотоэлектронного умножителя. Затем флуоресцентный сигнал в реальном времени передается процессором SP и отображается на компьютере.Нагреватель R1 расположен на расстоянии 0,25 мм от микрожидкостного чипа, что обеспечивает быстрый, равномерный двусторонний нагрев. Регулятор температуры (PID) используется для управления нагревателем R1 с точностью до 0,1 ° C и скоростью нагрева 1 ° Cs -1 посредством обратной связи от датчика температуры (S1 и S2). Многоосевой привод (MMD) используется для управления роторным двигателем с угловой точностью 0,01 °. На рисунке 3 (b) показана энергия в окружении дифракции с быстрым преобразованием Фурье (БПФ) для конфокального оптического детектирования портативного анализатора нуклеиновых кислот, что указывает на то, что сбор флуоресценции в поле визуализации диаметром 3 мм близок к пределу оптической дифракции и имеет адекватная чувствительность для обнаружения продуктов амплификации следов нуклеиновой кислоты в тестовой ячейке микрожидкостного чипа.

Фотография портативного анализатора нуклеиновых кислот и основной процесс идентификации нескольких патогенов параллельно с использованием анализатора показаны на рис. 1. Следовые нуклеиновые кислоты патогенных бактерий сначала извлекались из мокроты стационарных и амбулаторных пациентов, а затем смешивались с реагенты для изотермической амплификации нуклеиновых кислот в микроцентрифужной пробирке объемом 1 мл. Затем смесь вводили в микрожидкостный чип и центрифугировали при 5000 об / мин в течение 10 с. Затем микрофлюидный чип помещали в портативный анализатор нуклеиновых кислот для инкубации при 65 ° C в течение 45 мин.Были обнаружены сигналы флуоресценции амплифицированных продуктов, и кривые амплификации нуклеиновых кислот отображались в реальном времени.

EvaGreen использовали для отслеживания амплификации нуклеиновой кислоты в режиме реального времени. Как правило, свободный EvaGreen не флуоресцирует, но когда он связывается с двухцепочечной ДНК (, например, , продукты амплификации нуклеиновых кислот), он может возбуждаться синим светом и излучать флуоресцентный сигнал. Свободный EvaGreen был смешан с тестами изотермической амплификации.Следовательно, когда амплификация нуклеиновой кислоты выполняется в присутствии ДНК патогена, продукты амплификации производятся постоянно, и EvaGreen связывается с ними. Портативный анализатор нуклеиновых кислот может обнаруживать усиление сигнала флуоресценции в режиме реального времени, и получаются экспоненциально возрастающие кривые амплификации нуклеиновых кислот. Если ДНК патогена отсутствует, амплификация нуклеиновой кислоты не происходит, и свободный EvaGreen не излучает флуоресцентный сигнал. Таким образом, портативный анализатор нуклеиновых кислот не обнаруживает изменения флуоресценции, а кривые амплификации нуклеиновых кислот являются плоскими.В конечном итоге сообщается о результатах параллельного выявления нескольких патогенов.

Предел обнаружения, воспроизводимости и линейности микрожидкостного чипа на основе портативного анализатора нуклеиновых кислот

Предел обнаружения (LOD) микрожидкостного чипа на основе портативного анализатора нуклеиновых кислот оценивали с использованием серийного разведения очищенного геномного Sau . ДНК (гДНК). Шесть образцов матрицы гДНК с разными концентрациями (1,0 × 10 6 , 1,0 × 10 5 , 1.0 × 10 4 , 1,0 × 10 3 , 1,0 × 10 2 и 1,0 × 10 1 копий / мкл), а кривые амплификации показаны на рис. 4. Двадцать четыре дубликата реакции были выполнены для каждой концентрации матрицы ДНК, чтобы оценить воспроизводимость. Время до положительного значения (Tp), которое определяли как время перегиба второй производной кривых экспоненциальной амплификации ДНК, устанавливали для индикации инициации всей системы. Как показано на рис.4, LOD для изотермической амплификации составлял 10 копий гДНК для Sau для портативного микрофлюидного чипа на основе анализатора нуклеиновых кислот. Коэффициент вариации (CV), определяемый как отношение стандартного отклонения (SD) к среднему среднему (CV = SD / AVERAGE × 100%), использовали для описания относительной дисперсии значений Tp. Значение CV от 0 до 5% указывает на хорошую воспроизводимость, а от 5 до 10% указывает на приемлемую воспроизводимость. CV 24 повторных измерений равнялись 5.76%, 2,93%, 1,28%, 1,62%, 2,76% и 3,6% для концентраций ДНК 1,0 × 10 1 , 1,0 × 10 2 , 1,0 × 10 3 , 1,0 × 10 4 , 1,0 × 10 5 и 1,0 × 10 6 копий / мкл соответственно, демонстрируя хорошую воспроизводимость портативного анализатора нуклеиновых кислот. Кроме того, была определена взаимосвязь между значением Tp и количеством бактериальной гДНК на реакцию, и наблюдалась хорошая линейность (фиг. 4). Квадрат коэффициента регрессии ( 2 рэнд) составил 0.9906 для портативного анализатора нуклеиновых кислот. Это указывает на то, что микрожидкостный чип на основе портативного анализатора нуклеиновых кислот был надежным для количественной оценки бактерий с использованием традиционных стандартных кривых и был сопоставим с ABI 7500. LODs MRSA и Mpn были затем проанализированы с использованием портативной нуклеиновой кислоты. Микрожидкостный чип на основе анализатора (рис. 4 (В)). CV пяти повторных измерений при концентрации ДНК 10 копий составляли 5,2% и 4,95% для MRSA и Mpn соответственно.

Рис. 4

LOD и анализ линейности микрожидкостного чипа на основе портативного анализатора нуклеиновых кислот. ( A ) Анализ LOD для Sau . ( B ) Анализ линейности для Sau . ( C ) Анализ LOD для Mpn и MRSA.

Аналитическая специфичность

Специфичность нашей системы оценивалась с использованием подготовленных образцов гДНК от 13 патогенов LRT, включая три бактерии-мишени, описанные выше, и 10 других интерферирующих бактерий: Escherichia coli (Eco), Pseudomonas aeruginosa (Pae), Streptococcus pneumoniae ( Spn), Klebsiella pneumoniae (Kpn), Acinetobacter baumannii (Aba), Stenotrophomonas maltophilia (Sma), Haemophilus influenzae (Hin), Legionella pneumophila (Lpn), Chamydiae pneumonia (Cpn) и Mycobacterium tuberculosis 900 (Mycobacterium tuberculosis).Все тесты были повторены трижды. Ожидаемые положительные сигналы были распознаны типичными сигмоидальными кривыми амплификации (рис. 5), и только целевые бактерии показали положительные результаты. Эти данные показали, что другие 10 видов не привели к перекрестным реакциям, что указывает на высокую специфичность. Отрицательный контроль (в реакционную лунку не добавлены праймеры) не демонстрировал флуоресценции во время амплификации, что указывает на низкий фон сигнала и отсутствие загрязнения.

Рис. 5

Специфика анализа параллельного обнаружения на микрожидкостном чипе. ( A ) Результаты обнаружения нуклеиновой кислоты Sau . ( B ) Результаты обнаружения нуклеиновой кислоты MRSA. ( C ) Результаты обнаружения нуклеиновой кислоты Mpn . ( D ) Результаты обнаружения без ДНК H 2 O. ( E ) Результаты обнаружения трех патогенов-мишеней из смеси гДНК из 13 патогенов.

Валидация анализа микрожидкостного чипа на основе портативного анализатора нуклеиновых кислот слепым тестом 229 клинических образцов

Образцы выделений LRT от 229 пациентов были протестированы с использованием портативного анализатора нуклеиновых кислот на основе микрожидкостного чипа и прибора ABI 7500 вместе с 25 -мкл наборы кПЦР для одновременного обнаружения Sau , MRSA и Mpn ; полные результаты приведены в дополнительной информации 1.Среди 229 пациентов было 127 детей (возраст <14 лет), 31 человек молодого и среднего возраста (возраст от 15 до 60) и 71 человек пожилого возраста (возраст> 60 лет). Соотношение мужчин и женщин составило 149: 80. Мы обнаружили, что 225 образцов были правильно идентифицированы, включая 95 положительных и 130 отрицательных результатов. Чтобы определить чувствительность и специфичность, мы использовали четырехкратную таблицу для расчета, как показано в таблице 2, с подробным описанием процесса расчета. Согласованность результатов анализа LAMP на чипе и количественной ПЦР оценивали с помощью теста на коэффициент Каппа (κ).

Таблица 2 Четырехкратная таблица для расчета результатов испытаний Sau , MRSA и Mpn .

Клиническая чувствительность и специфичность для трех патогенов обобщены в таблице 3. Все они были> 99%, за исключением чувствительности обнаружения Mpn , которая составила 94,3%. Κ составлял 0,975, 0,975 и 0,941 для Sau , MRSA и Mpn соответственно. Значения p были <10 −3 , а x 2 тестов парного сравнения переписных данных составили 1.000 для всех трех клинических целей, что свидетельствует о почти идеальном согласии между двумя платформами. Общие коэффициенты совпадения с ABI 7500 составили> 98%, что указывает на высокую согласованность между двумя платформами.

Таблица 3 Коэффициенты совпадения двух методов тестирования на наличие трех бактерий.

Анализ несоответствия образца

По сравнению с результатами, полученными с ABI 7500, четыре клинических образца дали разные результаты тестирования с помощью нашего портативного анализатора нуклеиновых кислот.Мы повторно проанализировали четыре образца с использованием двух устройств, и результаты были такими же, как и раньше (дополнительная информация 1), что указывает на стабильность результатов на обеих платформах. Чтобы дополнительно проверить результаты этих четырех образцов, мы отправили их на секвенирование ДНК, которое считается золотым стандартом. Результаты секвенирования лучше соответствовали результатам портативного анализатора нуклеиновых кислот, чем ABI 7500, как показано в таблице 4. Мы обнаружили, что эти четыре образца имели очень низкую бактериальную концентрацию (~ 1.0 × 10 1 копий / мкл). Это указывает на то, что портативный анализатор нуклеиновых кислот превосходит ABI 7500 для анализа следов образцов и особенно эффективен для разбавленных клинических образцов.

Таблица 4 Несоответствие результатов повторного анализа пробы.

Усовершенствованный портативный анализатор нуклеиновых кислот на основе микрожидкостного чипа был одобрен в качестве нового медицинского устройства (№ 20153400580) Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов Китая (CFDA) 20 апреля 2015 года и признан технологическим стандартом медицинского класса III. установка для его производства (CapitalBio Co., Пекин, Китай) и применение в клинике.

Инфекции, передаваемые половым путем (ИППП)


Известно, что более 30 различных бактерий, вирусов и паразитов передаются половым путем. Восемь из этих патогенов связаны с наибольшей частотой заболеваний, передающихся половым путем. Из них 4 в настоящее время излечимы: сифилис, гонорея, хламидиоз и трихомониаз. Остальные 4 — это неизлечимые вирусные инфекции: гепатит В, вирус простого герпеса (ВПГ или герпес), ВИЧ и вирус папилломы человека (ВПЧ).

ИППП передаются преимущественно половым путем, включая вагинальный, анальный и оральный секс. Некоторые ИППП также могут передаваться от матери к ребенку во время беременности, родов и грудного вскармливания.

Человек может заразиться ИППП без симптомов болезни. Общие симптомы ИППП включают выделения из влагалища, выделения из уретры или жжение у мужчин, язвы на половых органах и боль в животе.

Масштаб проблемы

ИППП оказывают огромное влияние на сексуальное и репродуктивное здоровье во всем мире.

Ежедневно приобретается более 1 миллиона ИППП. В 2020 году ВОЗ оценила 374 миллиона новых случаев инфицирования одной из четырех ИППП: хламидиозом (129 миллионов), гонореей (82 миллиона), сифилисом (7,1 миллиона) и трихомониазом (156 миллионов). По оценкам, в 2016 году более 490 миллионов человек жили с генитальной инфекцией ВПГ (герпес), а около 300 миллионов женщин инфицированы ВПЧ, основной причиной рака шейки матки. По оценкам, 296 миллионов человек живущие с хроническим гепатитом B во всем мире.И ВПЧ, и гепатит В можно предотвратить с помощью вакцинации.

ИППП могут иметь серьезные последствия, помимо непосредственного воздействия самой инфекции.

  • ИППП, такие как герпес, гонорея и сифилис, могут повысить риск заражения ВИЧ.
  • Передача ИППП от матери ребенку может привести к мертворождению, неонатальной смерти, малой массе тела и недоношенности, сепсису, пневмонии, конъюнктивиту новорожденных и врожденным деформациям. По оценкам, примерно у 1 миллиона беременных женщин активный сифилис в 2016 г. привел к более чем 350 000 неблагоприятных исходов родов, из которых 200 000 произошли в результате мертворождения или неонатальной смерти.
  • Инфекция ВПЧ вызывает рак шейки матки. Рак шейки матки является четвертым по распространенности онкологическим заболеванием среди женщин во всем мире: по оценкам, в 2018 г. было зарегистрировано 570 000 новых случаев, а ежегодно от рака шейки матки умирало более 311 000 человек (2) .
  • Гепатит B привел к примерно 820 000 смертей в 2019 году, в основном от цирроза и гепатоцеллюлярной карциномы (первичный рак печени).
  • ИППП, такие как гонорея и хламидиоз, являются основными причинами воспалительных заболеваний органов малого таза (ВЗОМТ) и бесплодия у женщин.

Профилактика ИППП

При правильном и постоянном использовании презервативы являются одним из наиболее эффективных методов защиты от ИППП, включая ВИЧ. Презервативы также защищают от нежелательной беременности при сексуальных отношениях по обоюдному согласию. Хотя презервативы очень эффективны, не обеспечивают защиту от ИППП, вызывающих экстрагенитальные язвы (например, сифилис или генитальный герпес). По возможности следует использовать презервативы при вагинальном и анальном сексе.

Доступны безопасные и высокоэффективные вакцины от 2 вирусных ИППП: гепатита В и ВПЧ.Эти вакцины представляют собой значительный прогресс в профилактике ИППП. К концу 2020 г. вакцина против ВПЧ была внедрена в рамках плановой программы иммунизации в 111 стран, большинство из которых имеют высокий и средний доход. Вакцинация против ВПЧ может предотвратить смерть миллионов женщин в течение следующего десятилетия в странах с низким и средним уровнем доходов, где встречается большинство случаев рака шейки матки, при высоком (> 80%) охвате вакцинацией. молодых женщин (возраст 11–15).

Исследования по разработке вакцин против герпеса и ВИЧ продолжаются, и несколько вакцин-кандидатов находятся на ранней стадии клинической разработки.Появляется все больше свидетельств того, что вакцина для предотвращения менингита (MemB) обладает перекрестной защитой от гонореи. Необходимы дополнительные исследования вакцин от хламидиоза, гонореи, сифилиса и трихомониаза.

Другие биомедицинские вмешательства для предотвращения некоторых ИППП включают обрезание взрослых мужчин и микробициды.

Диагностика ИППП

Точные диагностические тесты на ИППП широко используются в странах с высоким уровнем доходов. Они особенно полезны для диагностики бессимптомных инфекций.Однако диагностические тесты в основном недоступны в странах с низким и средним уровнем доходов. Где тестирование доступен, он часто бывает дорогостоящим и географически недоступным, и пациентам часто приходится ждать долгое время (или нужно возвращаться), чтобы получить результаты. В результате последующее наблюдение может быть затруднено, а уход или лечение могут быть неполными.

В настоящее время доступны только недорогие быстрые тесты на ИППП, на сифилис, гепатит В и ВИЧ. Экспресс-тест на сифилис уже используется в некоторых странах с ограниченными ресурсами.Теперь доступен двойной экспресс-тест на ВИЧ / сифилис, с помощью которого человек может пройти тестирование на ВИЧ и сифилис одним пальцем и с помощью одного картриджа. Эти тесты точны, могут дать результаты за 15–20 минут и просты в использовании при минимальном обучении. Было показано, что экспресс-тесты на сифилис увеличивают количество беременных, прошедших тестирование на сифилис. Однако в большинстве стран с низким и средним уровнем доходов по-прежнему необходимы более активные усилия для обеспечения того, чтобы все беременные женщины прошли тест на сифилис при первом посещении дородовой помощи.

Несколько экспресс-тестов на другие ИППП находятся в стадии разработки и могут улучшить диагностику и лечение ИППП, особенно в условиях ограниченных ресурсов.

Лечение ИППП

В настоящее время доступно эффективное лечение нескольких ИППП.

  • Три бактериальных ИППП (хламидиоз, гонорея и сифилис) и одна паразитарная ИППП (трихомониаз) обычно излечимы с помощью существующих схем однократного приема антибиотиков.
  • Для лечения герпеса и ВИЧ наиболее эффективными лекарствами являются противовирусные препараты, которые могут модулировать течение болезни, но не могут вылечить болезнь.
  • При гепатите B противовирусные препараты могут помочь бороться с вирусом и замедлить повреждение печени.

Устойчивость к противомикробным препаратам (УПП) ИППП, в частности гонореи, к антибиотикам в последние годы быстро возросла и сократила варианты лечения. Программа эпиднадзора за гонококковой УПП (GASP) показала высокие показатели устойчивости ко многим антибиотикам, включая устойчивость к хинолонам, повышение устойчивости к азитромицину и возникающую устойчивость к цефалоспоринам расширенного спектра, лечение последней линии, повышающее риск неизлечимости гонореи (4) .

УПП для других ИППП, хотя и менее распространен, также существует, что делает профилактику и своевременное лечение критически важными.

Ведение случаев ИППП

Страны с низким и средним уровнем доходов полагаются на выявление последовательных, легко распознаваемых признаков и симптомов для определения курса лечения без использования лабораторных тестов. Это называется синдромным лечением. Этот подход, который часто основан на клинических алгоритмах, позволяет медицинским работникам диагностировать конкретную инфекцию на основе наблюдаемых синдромов (например,g., выделения из влагалища, выделения из уретры, генитальные язвы, боль в животе).

Синдромное лечение простое, обеспечивает быстрое лечение в тот же день и позволяет избежать дорогостоящих или недоступных диагностических тестов для пациентов с симптомами. Такой подход приводит к чрезмерному лечению и пропуску лечения, поскольку большинство ИППП протекают бессимптомно. Таким образом, ВОЗ рекомендует странам улучшать синдромное лечение, постепенно внедряя лабораторное тестирование для подтверждения диагноза. В условиях, когда доступны молекулярные анализы гарантированного качества, рекомендуется лечить ИППП на основе лабораторных тестов.Кроме того, стратегии скрининга на ИППП важны для лиц из группы повышенного риска, таких как секс-работники, мужчины, практикующие секс с мужчинами, подростки в некоторых местах и ​​беременные женщины из-за потенциально серьезных последствий для младенцев.

Чтобы прервать передачу инфекции и предотвратить повторное инфицирование, лечение половых партнеров является важным компонентом ведения случаев ИППП.

Контроль распространения

Изменение поведения — сложный процесс

Несмотря на значительные усилия по определению простых вмешательств, которые могут снизить рискованное сексуальное поведение, изменение поведения остается сложной задачей.Исследования продемонстрировали необходимость сосредоточить внимание на тщательно определенных группах населения, широко консультироваться с выявленные целевые группы населения и вовлекать их в разработку, реализацию и оценку.

Образование и консультирование могут улучшить способность людей распознавать симптомы ИППП и повысить вероятность того, что они обратятся за помощью, и побудят к этому сексуального партнера. К сожалению, недостаточная осведомленность общественности, отсутствие подготовки среди работники здравоохранения и давняя широко распространенная стигма в отношении ИППП остаются препятствиями на пути более широкого и эффективного использования этих вмешательств.

Медицинские услуги по скринингу и лечению ИППП остаются слабыми

Люди, обращающиеся за обследованием и лечением ИППП, сталкиваются с многочисленными проблемами. К ним относятся ограниченные ресурсы, стигматизация, низкое качество услуг и часто наличные расходы.

Маргинальные группы населения с самым высоким уровнем ИППП, такие как работники секс-бизнеса, мужчины, практикующие секс с мужчинами, люди, употребляющие инъекционные наркотики, заключенные, мобильные группы населения и подростки, часто не имеют доступа к адекватному и безопасному здоровью Сервисы.

Во многих странах услугами по лечению ИППП в странах с низким и средним уровнем доходов часто пренебрегают и им не хватает финансирования. Эти проблемы приводят к трудностям в проведении скрининга на бессимптомные инфекции, недостаточному количеству обученного персонала, ограниченной лаборатории. потенциал и недостаточные запасы соответствующих лекарств.

Ответные меры ВОЗ

В настоящее время наша работа руководствуется Глобальной стратегией сектора здравоохранения по инфекциям, передаваемым половым путем, 2016 г. –2021 . В рамках этой структуры ВОЗ:

  • разрабатывает глобальные нормы и стандарты для лечения и профилактики ИППП
  • поддерживает оценку заболеваний и экономического бремени ИППП
  • во всем мире осуществляет мониторинг устойчивости к противомикробным препаратам к гонореи
  • лидирует в установлении глобального программа исследований по ИППП, включая разработку:
    • доступные и простые в использовании диагностические тесты
    • вакцины против ИППП
    • дополнительные лекарства от гонореи и сифилиса.

В рамках своей миссии ВОЗ поддерживает страны в:

  • реализации медицинских вмешательств для уменьшения их бремени ИППП
  • усилить и расширить масштабы медицинских вмешательств для воздействия, таких как:
    • Вакцинация против гепатита В и ВПЧ
    • Скрининг на сифилис беременных женщин и групп населения с повышенным риском ИППП
  • укрепить их возможности по мониторингу тенденций в отношении ИППП для улучшения своих программ
  • Мониторинг устойчивости к противомикробным препаратам при гонорее и реагирование на нее.

  1. Джеймс К., Харфуш М., Велтон Нью-Джерси и др. Вирус простого герпеса: глобальные оценки распространенности и заболеваемости, 2016 г. Bull World Health Organ. 2020; 98 (5): 315-329. doi: 10.2471 / BLT.19.237149
  2. Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Глобальная статистика рака 2018: оценки GLOBOCAN заболеваемости и смертности от 36 раковых заболеваний в 185 странах во всем мире. CA Cancer J Clin. 2018 ноя; 68 (6): 394-424.DOI: 10.3322 / caac.21492. Epub 2018, 12 сентября. Ошибка в: CA Cancer J Clin. 2020 Июль; 70 (4): 313. PMID: 30207593. https://doi.org/10.1371/journal.pone.0211720
  3. Unemo M, Lahra MM, Escher M, Eremin S, Cole MJ, Galarza P, Ndowa F, Martin I, Dillon JR, Galas M , Ramon-Pardo P, Weinstock H, Wi T. Глобальный надзор ВОЗ за устойчивостью к противомикробным препаратам (GASP / GLASS) для Neisseria gonorrhoeae 2017-2018: ретроспектива наблюдательное исследование. Ланцетный микроб. Сентябрь.

Диагностика патогенов с помощью смартфона у пациентов с мочевым сепсисом

https: // doi.org / 10.1016 / j.ebiom.2018.09.001Получить права и контент



Существует острая потребность в быстрой, чувствительной и доступной диагностике микробных инфекций в местах оказания медицинской помощи. Хотя сообщалось о ряде инновационных систем, которые превращают мобильные телефоны в потенциальные диагностические инструменты, проблема перевода в клиническую диагностику остается серьезным препятствием, которое необходимо преодолеть.


Система изотермической изотермической амплификации в реальном времени на базе смартфона (smaRT-LAMP) была разработана для идентификации патогенов у пациентов с мочевым сепсисом.Бесплатное специально разработанное приложение для мобильного телефона позволяет телефону служить автономным устройством для количественной диагностики, позволяя определять количество копий генома бактериальных патогенов в режиме реального времени.


Непосредственный сравнительный бактериальный анализ мочи пациентов с сепсисом показал, что эффективность smaRT-LAMP сравнялась с клинической диагностикой в ​​госпитале за долю времени (~ 1 час против 18–20 минут). 28ч). Среди пациентов с бактериемическими осложнениями мочевого сепсиса идентификация патогена в моче соответствовала таковой в крови, что потенциально позволяло диагностировать патоген вскоре после госпитализации.Кроме того, smaRT-LAMP не давал ложноположительных результатов у пациентов с сепсисом с клинически отрицательными культурами мочи.


Система smaRT-LAMP эффективна против различных грамотрицательных и положительных патогенов и биологических образцов, ее изготовление стоит менее 100 долларов США (в дополнение к смартфону), и ее можно настроить для одновременного обнаружения нескольких патогенов. . Таким образом, SmaRT-LAMP предлагает возможность быстрой диагностики и лечения инфекций мочевыводящих путей и сепсиса мочевыводящих путей с помощью простого теста, который можно провести с небольшими затратами в месте оказания медицинской помощи.


Национальные институты здравоохранения, Биохаб Чана-Цукерберга, Фонд Билла и Мелинды Гейтс.

Ключевые слова

Диагностика патогенов с помощью смартфона

Мочевой сепсис

Инфекция мочевыводящих путей

Диагностический тест мочи

Рекомендуемые статьиЦитирующие статьи (0)

© 2018 Авторы. Опубликовано Elsevier B.V.

Рекомендуемые статьи

Цитирующие статьи

Антилейшманиальные эффекты, направляемые патогенами и хозяевами, опосредованные полигексанидом (PHMB)



Кожный лейшманиоз (КЛ) — это забытое тропическое заболевание, вызываемое простейшими паразитами рода Leishmania .CL причиняет огромные страдания во многих странах мира. Лицензированной вакцины против CL не существует, а варианты химиотерапии демонстрируют ограниченную эффективность и высокую токсичность. Локализация паразитов внутри клеток-хозяев является препятствием для большинства стандартных химио- и иммунных вмешательств. Следовательно, отчаянно необходимы новые лекарства, которые являются безопасными, эффективными и легкодоступными для стран третьего мира, и / или технологии доставки лекарств для эффективного лечения ХЛ.

Методология / основные выводы

Здесь мы оценили антилейшманиальные свойства и потенциал доставки полигексаметилен бигуанида (PHMB; полигексанид), широко используемого антимикробного и раневого антисептика, в модели Leishmania .PHMB показал присущую антилейшманиозную активность при субмикромолярных концентрациях. Наши данные показали, что PHMB убивает Leishmania major ( L . major) через по двойному механизму, включающему нарушение целостности мембраны и селективную конденсацию и повреждение хромосом. Свойства связывания ДНК PHMB и входа в клетку-хозяина дополнительно использовали для улучшения доставки и иммуномодулирующей активности неметилированных цитозин-фосфат-гуаниновых олигодезоксинуклеотидов (CpG ODN).PHMB спонтанно связывает CpG ODN, образуя стабильные нанополиплексы, которые усиливают поглощение CpG ODN, усиливают антимикробное уничтожение и снижают токсичность PHMB для клеток-хозяев.


Учитывая его низкую стоимость и долгую историю безопасного местного применения, PHMB является многообещающим лекарством для терапии ХЛ и средством доставки иммуномодуляторов нуклеиновых кислот.

Сведения об авторе

Внутриклеточные патогены трудно убить, поскольку их локализация внутри клеток-хозяев обеспечивает защиту от иммунитета и химиотерапии.Таким образом, для успешного лечения заболеваний, вызванных внутриклеточными патогенами, может потребоваться комбинированная терапия и эффективные системы доставки. Кожный лейшманиоз (КЛ) вызывается внутриклеточными простейшими патогенами рода Leishmania . ХЛ — давно сложившаяся глобальная проблема, однако подходящих вариантов вакцины или химиотерапии не существует. Мы обнаружили, что хорошо переносимый катионный полимер PHMB способен непосредственно уничтожать Leishmania major ( L . major) и усиливать управляемое хозяином уничтожение путем улучшения доставки иммуномодулирующих нуклеиновых кислот.Исследование демонстрирует параллельное уничтожение внутриклеточного патогена, направленное на хозяина и патоген, в присутствии эффективных платформ доставки лекарств. Эта общая стратегия имеет большие перспективы для лечения ряда заболеваний, вызываемых внутриклеточными патогенами.

Образец цитирования: Фирдесса Р., Гуд Л., Амстальден М.С., Чиндера К., Камаруцзаман Н.Ф., Шультейс М. и др. (2015) Антилейшманиальные эффекты, управляемые патогенами и хозяином, опосредованные полигексанидом (PHMB). PLoS Negl Trop Dis 9 (10): e0004041.https://doi.org/10.1371/journal.pntd.0004041

Редактор: Мэри Энн Макдауэлл, Университет Нотр-Дам, США

Поступила: 14 апреля 2015 г .; Принята к печати: 6 августа 2015 г .; Опубликовано: 2 октября 2015 г.

Авторские права: © 2015 Firdessa et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника

Доступность данных: Все соответствующие данные находятся в пределах документ и вспомогательные информационные файлы к нему.

Финансирование: РФ было поддержано стипендиями German Excellence Initiative для Высшей школы естественных наук и DAAD STIBET Abschlussbeihilfe, Вюрцбургский университет, Германия. MCA поддерживается программой «Наука без границ», Фондом CAPES, Министерством образования Бразилии, Бразилиа. Мы благодарны за поддержку SFB 630 Deutsche Forschungsgemeinschaft (DFG). Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: РФ, LG и HM имеют или подали заявки на патенты по этой теме. Все остальные авторы заявили, что никаких конкурирующих интересов не существует. Это не влияет на нашу приверженность политике PLOS по обмену данными и материалами.


Лейшманиоз существовал веками как опасное для жизни и обезображивающее заболевание, эндемичное в 98 странах по всему миру, с общей оценочной распространенностью 12 миллионов и ежегодной заболеваемостью 2 миллионами новых случаев [1,2].В основном это затрагивает беднейшие регионы мира, где пациенты не могут позволить себе лекарства. Он также эндемичен в нескольких развитых странах, включая Францию ​​и Испанию, и есть сообщения о росте случаев лейшманиоза в развитых странах, где болезнь считается неэндемичной [3,4]. Лейшманиоз классически подразделяется на три основные клинические формы: кожную, кожно-слизистую и висцеральную. Две трети всех случаев во всем мире представляют собой проявления кожного лейшманиоза (КЛ) [2,5,6].Симптомы ХЛ варьируются от единичных самозаживающих кожных ран до стойкого метастатического заболевания [7]. Основа для таких разнообразных патологий является многофакторной и сложной, а функционирование врожденной иммунной системы и ее рецепторы распознавания образов являются определяющими факторами [7,8]. Таким образом, иммунитет хозяина является решающим фактором, влияющим на исход инфекции Leishmania . Кроме того, паразиты Leishmania манипулируют и подрывают иммунные ответы хозяина. Например, L . основная инфекция сдвигает клеточный иммунитет, связанный с цитокинами, такими как интерлейкин (IL) -12, интерферон гамма (IFN-γ) и фактор некроза опухоли (TNF) -α, продуцирующий Th2 CD4 + T-лимфоцитов, на гуморальный иммунитет, связанный с с (Th3) CD4 + ответы Т-лимфоцитов у восприимчивых хозяев [9–11]. Напротив, отклонение иммунной системы хозяина в сторону Th2 приводит к эффективному удалению паразита от хозяина и является многообещающим подходом для внутриклеточной терапии патогенов.

CL — это тропическая болезнь, которой не уделяют должного внимания, и медицина не обеспечивает подходящей терапии. Доступные методы лечения устарели, и системные побочные эффекты часто перевешивают любые клинические преимущества [12,13]. После десятилетий исследований в области разработки лекарств до сих пор нет нового коммерческого препарата для лечения ХЛ. Большинство пациентов в пострадавших регионах бедны и не могут позволить себе лекарства, что препятствует инвестициям в фармацевтическую промышленность. Большой интерес представляют альтернативные подходы к лечению, которые являются безопасными, эффективными и легко доступными для стран третьего мира.Среди нескольких стратегий открытия лекарств репозиционирование существующих лекарств от других областей болезней считается рентабельной стратегией и учитывает многие используемые в настоящее время противопаразитарные препараты, и, таким образом, исторически играло важную роль в разработке антипаразитарных лекарств [ 14]. Например, амфотерицин B, милтефозин и паромомицин были изменены для лечения лейшманиозов.

Текущие схемы лечения CL могут быть как местными, так и системными. Выбор системной или местной терапии основан на подвидах Leishmania , географических регионах, тяжести заболевания и иммунном статусе пациента [15,16].Сложные случаи, такие как пациенты с более чем тремя поражениями, единичное поражение размером> 40 мм в диаметре, поражение в косметически и функционально деликатных частях тела (таких как лицо, суставы, кожно-слизистые зоны, лимфатические узлы) и пациенты с ослабленным иммунитетом, должны лечиться системно [16 ]. Парентеральное введение сурьмы, пентамидина, амфотерицина В или милтефозина перорально является стандартным системным лечением ХЛ. Однако их эффективность ограничена несколькими факторами, включая значительную токсичность и другие побочные эффекты [2,3,15,17].Местное лечение, такое как мазь с паромомицином и инфильтрация сурьмой, рекомендовано Всемирной организацией здравоохранения (ВОЗ) в качестве лечения первой линии для неосложненных случаев ХЛ [2]. Хотя местные методы лечения имеют значительные преимущества перед системной терапией, они еще не показали сильного и стойкого эффекта. В целом, доказательств потенциальной пользы текущих методов лечения ХЛ недостаточно. Недостаточное уничтожение скрытых паразитов внутри макрофагов и недостаточная концентрация лекарства в дерме являются факторами, которые, по-видимому, препятствуют его клиническому применению [18,19], что указывает на необходимость улучшенных стратегий доставки, абсорбции и удержания лекарств.Важно отметить, что было показано, что липосомы, нагруженные лекарствами, усиливают проникновение in vitro лекарства через обнаженную кожу и улучшают антилейшманиальную активность in vivo у экспериментально инфицированных мышей [12,20,21]. Кроме того, модуляция иммунной микросреды для лечения ХЛ, направленного на хозяина, была предложена в качестве потенциальной терапевтической и профилактической стратегии [22]. Действительно, иммуномодуляция в ответ на Th2-ответы с использованием иммуномодулирующих агентов, таких как CpG ODN, показала многообещающую эффективность против лейшманиоза [23-25].Еще одно преимущество состоит в том, что CpG ODN может ускорять заживление ран [26,27]. Аналогичным образом было показано, что местное применение иммуномодулятора имиквимода способствует заживлению ран при ХЛ [21,28]. Следовательно, улучшенная композиция CpG ODN может стабилизировать олигомеры против деградации, усилить поглощение клетками, увеличить гибель внутри макрофагов и способствовать заживлению ран.

PHMB — синтетический катионный полимер, рекомендованный в качестве лечения первого выбора для локально инфицированных и критически колонизированных ран [29].PHMB обладает антимикробным действием и используется для лечения некоторых паразитарных инфекций, но нет сообщений о его применении против внутриклеточных патогенов или видов Leishmania . Помимо прямого противомикробного действия, PHMB может опосредовать доставку других терапевтических средств. Несколько синтетических и природных катионных полимеров используются в качестве носителей нуклеиновых кислот, образуя полиплексные (любой комплекс полимера и нуклеиновых кислот) наноструктуры за счет их способности конденсировать нуклеиновые кислоты в частицы, позволяя при этом диссоциацию внутри клетки [30,31].Следовательно, PHMB имеет потенциал двойного применения против инфекций, обеспечивая как прямое уничтожение патогенов, так и усиленную доставку нуклеиновых кислот, которые могут модифицировать иммунную систему для усиления уничтожения.

Здесь мы стремились исследовать потенциальное использование PHMB в качестве антилейшманиального агента и в качестве невирусного носителя нуклеиновых кислот CpG ODN. Мы обнаружили, что сам по себе PHMB обладает мощной лейшманицидной активностью при субмикромолярных концентрациях. Лейшманицидные механизмы действия PHMB, по-видимому, включают нарушение клеточных мембран паразитов, проникновение в клетки и конденсацию / разрушение хромосом паразитов.Кроме того, мы обнаружили, что PHMB спонтанно связывает CpG ODN и образует стабильные нанополиплексы, взаимодействуя с CpG ODN при соответствующих дозировках. PHMB также защищает и стимулирует клеточное поглощение CpG ODN. Интересно, что нанополиплексы эффективно противодействуют токсичности, связанной с PHMB, взаимодействуя с отрицательно заряженными CpG ODN посредством образования комплекса / экранирования заряда. Следовательно, PHMB / CpG ODN может обеспечивать комбинированный лейшманицидный эффект, направленный на хозяина и патогена, против CL и может обеспечивать множество преимуществ для терапии CL.


Культура клеток

BMDM были получены из костного мозга мышей BALB / c (Charles River Breeding Laboratories, Зульцфельд, Германия) и культивированы в течение 6 дней при 37 ° C и 5% CO 2 , как недавно описано [32]. Затем первичный BMDM собирали и поддерживали в полной безфенольной среде Roswell Park Memorial Institute (RPMI), содержащей 10% фетальной телячьей сыворотки (инактивированной нагреванием при 56 ° C в течение 30 минут), 2 мМ L-глутамина, 10 мМ буфера HEPES. , 0,05 мМ раствор β-меркаптоэтанола, гентамицин (50 мкг / мл) и пенициллин G (100 ед / мл) для всех экспериментов.Такие же среды использовались в L . основных экспериментов с паразитами . Эпителиальные клетки почек 293T (DSMZ-No ACC-635, Брауншвейг, Германия) культивировали и поддерживали в среде DMEM с высоким содержанием глюкозы (4,5 г / л) без L-глутамина и фенолового красного, но содержащей 10% фетальной телячьей сыворотки (инактивированной нагреванием). 200 мМ L-глутамин и пируват натрия. Кальциевая температура взрослого человека (HaCaT, кератиноциты) была получена от доктора Амира Шарили, Лондонский университет королевы Марии. Кератиноциты культивировали в среде DMEM, содержащей 10% фетальной бычьей сыворотки, с 4.5 г глюкозы / л, 0,11 г пирувата натрия / л и 0,584 г / л L-глутамина.

Анализ AlamarBlue

Цитотоксичность различных соединений или составов против клеток млекопитающих (BMDM или эпителиальные клетки 293T) и L . основных промастиготов определяли, как описано ранее [33]. Вкратце, 4 × 10 4 клеток млекопитающих или 10 × 10 6 вирулентных L . основных промастигот (штамм MHOM / IL / 81 / FE / BNI) в логарифмической фазе роста добавляли в каждую лунку 96-луночных планшетов и культивировали с пятью возрастающими концентрациями каждого соединения при 37 ° C или 27 ° C в течение 24 ч соответственно.Стандартные антилейшманиальные препараты, включая амфотерицин B (A2942), пентамидин изотионат (P0547) и сульфат паромомицина (P9297) от Sigma-Aldrich (Дайзенхофен, Германия) и милтефозин (1-гексадецилфосфорилхолин) (Cayman Chemical Company, США). используется в качестве положительного контроля. Краситель AlamarBlue (Trinova Biochem GmbH, Гиссен, Германия) добавляли в каждую лунку в концентрации 10% и инкубировали еще 48 часов. Затем измеряли оптическую плотность (OD) с помощью ридера Multiskan Ascent ELISA при длине волны 550 нм и 630 нм.Значение OD или% уменьшения красителя пропорционально количеству жизнеспособных клеток / паразитов и использовалось для расчета IC 50 на основе теоремы о перехвате.

Репортерный анализ люциферазы (анализ амастигот)

Анализ основан на измерении биолюминесценции люциферазы светлячков, которая катализирует образование света из АТФ и люциферина. Вирулентная трансгенная люцифераза (Luc-tg) L . Штамм major , содержащий репортерный ген люциферазы светлячков, поддерживался непрерывным пассацией на самках мышей BALB / c и выращивался в 96-луночных культурах кровяного агара при 27 ° C, 5% CO 2 и влажности 95%.Трансгенная люцифераза L . мажорный штамм использовался для инфицирования BMDM в соответствии с недавно разработанным протоколом [34]. Вкратце, числа BMDM доводили до 2 × 10 5 , культивировали в 96-луночных планшетах и ​​инкубировали в течение 4 часов, чтобы обеспечить прилипание к поверхности. Число промастигот доводили до 3 × 10 6 паразитов на мл для достижения скорости инфицирования 1:15. Затем осуществляли инфицирование, отбрасывая супернатант культивируемых клеток и заменяя его равным объемом полной среды RPMI, содержащей суспензию промастигот.После инкубации инфицированного BMDM (37 ° C, 5% CO 2 ) в течение 24 часов для полной дифференциации промастигот в амастиготы среду, содержащую внеклеточных паразитов, удаляли, а лунки трижды промывали той же средой RPMI. . Пять серийных разведений каждого вещества (1: 5) в той же свежей среде RPMI добавляли к инфицированному BMDM в двух экземплярах с соответствующими контролями. После дополнительных 24 часов инкубации при 37 ° C и 5% CO 2, инфицированный BMDM лизировали люциферин-содержащим буфером (Britelite, PerkinElmer, Германия) и измеряли люминесценцию с помощью считывающего устройства для люминесцентных планшетов Victor X Light 2030. люминометр (PerkinElmer).Значения IC 50 соединений против внутриклеточных амастигот были рассчитаны на основе теоремы перехвата, как описано ранее [34,35].

Проточная цитометрия


красителей PI и YO-PRO-1 (Life Technologies, Дармштадт, Германия) промастиготами измеряли с помощью MACS Quant Analyzer (Miltenyi Biotec, Bergisch Gladbach, Германия) и использовали для определения целостности мембраны [36]. Краситель YO-PRO-1 избирательно проходит через плазматические мембраны апоптотических клеток, но не маркирует живые клетки [36]. Л. . основных промастиготов обрабатывали 2 мкМ PHMB в указанные моменты времени, а затем промывали при 3000 × g в течение 10 мин. Образцы окрашивали путем инкубации с красителями PI или YO-PRO-1 в течение 15 минут в темноте при комнатной температуре в соответствии с инструкциями производителя. Затем образцы были промыты, и с помощью проточной цитометрии было немедленно зарегистрировано в общей сложности 100 000 событий. Точно так же адгезивным клеткам BMDM позволяли поглощать флуоресцентный PHMB (конъюгат PHMB-FITC) в присутствии или в отсутствие пяти различных фармакологических ингибиторов (цитохалазин D (C8273, используемый в дозе 5 мкг / мл), вортманнин (W1628, используемый в 12). .85 мкг / мл), хлорпромазина гидрохлорид (C8138, используется в концентрации 10 мкг / мл), икаругамицин (SML0188, используется в концентрации 1 мкМ) и dynasore (D7693, используется в концентрации 25,8 мкг / мл), Sigma-Aldrich, Deisenhofen, Германия). PHMB (Polyhexamethylene biguanide; CAS # 27083-27-8; альтернативные химические названия: полигексанид, полиаминопропилбигуанид, M w = 2780 г / моль) [37] был предоставлен лабораторией доктора Лиама Гуда и Tecrea Ltd, Лондон, Великобритания (www.tecrea.co.uk), при исходных концентрациях 1 мг / мл и 200 мг / мл. PHMB представляет собой катионную и амфипатическую структуру, состоящую из повторяющихся основных звеньев бигуанидина, соединенных гексаметиленовыми углеводородными цепями.Структура и концентрации PHMB в процентах по весу / объему показаны в дополнительной информации (рис. S1 и таблица S1). PHMB (PHMB-FITC) был произведен в соответствии с недавно разработанным методом (более подробная информация будет предоставлена ​​в отдельной публикации, представленной Chindera et al.). Вкратце: 2 мг флуоресцеинизотиоцианата (FITC) растворяли в диметилформамиде, который содержит 50 мкл N, N-диизопропилэтиламина. Затем раствор смешивали с 50 мг PHMB в объеме 200 мкл и встряхивали в течение ночи при комнатной температуре.Полученную смесь диализовали с использованием мембраны с отсечкой по молекулярной массе 3,5 кДа против 50% водного этанола в течение 5 дней с периодической сменой диализата и лиофилизировали для получения флуоресцеинил-PHMB (PHMB-FITC). Кроме того, были получены полиплексы между PHMB и 3′-концом CpG ODN, меченным родаминовым красным (CpG-R) (M w = 6891 г / моль, последовательность TCCATGACGTTCCTGATGCT, Eurofins MWG Operon, Германия) в соотношении 1: 1 (w / w ) соотношение для изучения поглощения. Поилплексы и CpG-R инкубировали с BMDM в отсутствие или в присутствии ингибиторов эндоцитоза в различные моменты времени.BMDM собирали, промывали, разбавляли до 1 × 10 6 , и с помощью проточной цитометрии регистрировали в общей сложности 20000 событий на образец. Данные анализировали с помощью программного обеспечения FlowJo (Tree Star Inc., Калифорния, США).

Флуоресцентная микроскопия и конфокальная микроскопия

BMDM или промастиготы культивировали совместно с указанными дозами флуоресцентного PHMB в течение 24 или 48 часов. Образцы переносили в пробирки объемом 15 мл, промывали и фиксировали 4% параформальдегидом. ДНК L . основных промастиготов и BMDM контрастировали с помощью Hoechst 33342 (Life Technologies, h4570, Дармштадт, Германия). Наконец, 10 мкл раствора, содержащего паразитов или BMDM, добавляли к предметным стеклам и закрывали покровными стеклами для микроскопических исследований. Изображения получали с использованием систем флуоресценции живого видео и конфокальной микроскопии (Wetzlar, Германия).

Анализ сдвига электрофоретической подвижности (EMSA)

Геномная ДНК была выделена из 1,5 × 10 9 L . основных промастигот с использованием набора геномной ДНК Purelink (K1820-01, Life Technologies, Германия) и количественно определено с помощью спектрофотометра NanoDrop 2000 (Thermo Scientific, Германия ) . Составы полиплекса PHMB / гДНК получали добавлением и смешиванием 4,5 мкг гДНК с PHMB (0–54 мкг) в конечном объеме 30 мкл воды. Точно так же полиплексы PHMB / CPG ODN или PHMB / CpG-R получали смешиванием 30 мкг CpG ODN 1668 (M w = 6058 г / моль, последовательность TCCATGACGTTCCTGATGCT, Eurofins MWG Operon, Германия) или 15 мкг CpG-R с PHMB (0–54 мкг) в конечном объеме 30 мкл воды соответственно.После тщательного перемешивания пипеткой полиплексы оставляли при комнатной температуре на 2 ч перед анализом. Затем образцы объединяли с загрузочным красителем 6 × синий / оранжевый (Promega, Германия) и наносили на 1% агарозный гель, содержащий краситель геля нуклеиновой кислоты SYBR gold (S11494, Life Technologies, Германия) для электрофореза.

Просвечивающая электронная микроскопия

Просвечивающая электронная микроскопия (ПЭМ) была использована для определения размеров частиц и характеристики стабильности и морфологии полиплексов PHMB / CPG ODN.Для тестирования стабильности полиплексы получали смешиванием PHMB и CpG ODN в соотношении 2: 1 (мас. / Мас.) И выдерживали при 4 ° C в течение двух месяцев. Затем образцы помещали на сетку размером 300 меш, окрашивали уранилацетатом и цитратом свинца, анализировали с помощью ПЭМ (JEOL JEM-2100, Германия) при 80 кВ и 200 кВ с TVIPS F416 4k x 4k и Olympus Veleta 2k x 2k. системы и полученные при увеличении 4400 или 12000 x.

Динамическое рассеяние света (DLS) и электрофоретическое рассеяние света (ELS)

Размеры частиц и дзета-потенциал полиплексов PHMB / CpG ODN измеряли с использованием сошника Beckman Delsa Nano C (Beckman Coulter, Крефельд, Германия).Режим анализа CONTIN и уравнение Смолуховского использовались для определения размера и дзета-потенциала, соответственно. Измерения проводили в трех экземплярах и воспроизводили не менее двух раз. Измерения размера и дзета-потенциала проводили в чистых одноразовых кюветах, содержащих 500 мкл воды Millipore или воды с отрегулированной ионной силой (ISA) (KCl 0,15M) и полиплексов PHMB / CpG ODN в соотношении 2: 1 или 1: 1 (w / ш). Распределение среднего размера частиц полиплексов с их индексом полидисперсности (PDI) и значениями дзета-потенциала определяли с помощью DLS и ELS.Все измерения проводились при 25 ° C. Рассеянный свет детектировали под углом 165 ° (размер частиц) и 15 ° (дзета-потенциал).

Изотермическая калориметрия титрования (ITC)

Сродство и специфичность взаимодействий между PHMB и CpG ODN изучали путем прямого измерения тепла, выделяемого или поглощаемого во время событий связывания, с помощью системы MicroCal iTC200 (GE Healthcare Northampton, MA, США). Все образцы были разбавлены водой Millipore и дегазированы ультразвуком в течение 15 мин перед их использованием.Микрошприц на 40 мкл заполняли 0,3 мМ PHMB и вводили со скоростью 2 мкл / инъекцию в образцы клеток, содержащие 200 мкл 0,03 мМ CpG ODN, всего для 20 отдельных инъекций. Шприц для титранта действует как мешалка со скоростью 400 об / мин. Задержка стабилизации теплового сигнала перед первым впрыском составила 3 ​​мин. Интервал впрыска составлял 150 секунд, и использовалась калибровочная мощность 5 ± 0,5 мккал / сек. Измерения проводили трижды при 25 ° C. Фоновое тепло определяли путем титрования воды Millipore в CpG ODN и вычитали из основного эксперимента.Все данные были автоматически собраны и проанализированы с использованием программного обеспечения Origin и SigmaPlot для определения термодинамических параметров. Изотерма связывания ( ΔH ) была использована для подгонки к соответствующей модели.

Определение продукции цитокинов

BMDM были получены из самок мышей BALB / c, как описано выше в культуре клеток. 1 × 10 6 BMDM высевали в конечном объеме 0,5 мл в 24-луночные планшеты, инфицированные L . основных промастиготов при соотношении паразитов и BMDM 15: 1, промывали и инкубировали при 37 ° C в течение 30 мин в полной среде RPMI, содержащей CpG ODN (15 мкг / мл).Полиплексы PHMB, CpG ODN или PHMB / CpG ODN добавляли к предварительно активированным или контрольным клеткам и дополнительно инкубировали в течение 48 часов. Супернатанты собирали, и концентрации IL-6, IL-10, IL-4 или TNF-α (Biosciences, Висбаден, Германия) измеряли с помощью сэндвич-ELISA, в то время как IL-12p70 измеряли с использованием IL-12p70 ELISA Ready-SET- Используйте комплект от eBioscience в соответствии с инструкциями поставщиков.

Статистический анализ

Нормализация и процентные расчеты основывались на средней интенсивности флуоресценции (MFI) обработанных клеток по сравнению с контролем при анализе данных проточной цитометрии.Значения даны как среднее ± стандартная ошибка (SE). Статистическую значимость определяли с помощью t-критерия для одного образца (программное обеспечение Microsoft Excel).

Заявление об этике

Все мыши, использованные в этом эксперименте, содержались в определенных условиях, свободных от патогенов, и с ними обращались в строгом соответствии с Законом Германии о защите животных 2006 г. (TierSchG). Протокол на животных был одобрен правительством Нижней Франконии, Германия с номером разрешения: 55.2 –2531.01-26 / 12.


Антилейшманиальные эффекты PHMB и предполагаемые механизмы его действия

Для исследования возможности использования PHMB в качестве местного терапевтического средства против CL, его антилейшманиальной активности против внеклеточной формы L . major (промастиготы) оценивали с помощью анализа жизнеспособности клеток AlamarBlue [33]. PHMB эффективно убивал промастиготы при субмикромолярных концентрациях дозозависимым образом (S2, фиг.). Определение 50% ингибирующих концентраций (значения IC 50 ) подтвердило активность PHMB (IC 50 = 0,41 мкМ) против L . основных промастигот in vitro с более высокой эффективностью, чем стандартные антилейшманиальные препараты, применяемые в настоящее время в клиниках (таблица 1).Было обнаружено, что PHMB в 39 раз более эффективен, чем пентамидин, в 69 раз более эффективен, чем милтефозин, и в 1000 раз более эффективен, чем паромомицин, который в настоящее время рекомендуется для лечения CL. Визуальные исследования с помощью световой микроскопии и ПЭМ четко выявили морфологические и поведенческие изменения промастигот после лечения PHMB (рис. 1). Кроме того, мы исследовали биологическую активность PHMB против внутриклеточной формы паразита (амастиготы) на модели макрофагов, инфицированных Leishmania- .Значение IC 50 PHMB против внутриклеточных амастигот составляло 4 мкМ, что позволяет предположить, что эффективность PHMB ниже против амастигот по сравнению с промастиготами.

Рис. 1. Воздействие PHMB на L . major морфология и поведение.

(б и г) ПЭМ-изображения L . основных промастиготов (справа) с морфологическими изменениями, такими как усадка, обширная вакуолизация цитоплазмы (V), заметная потеря цитозольного содержимого и конденсированное ядро ​​(N).Изображения b и d были получены после обработки 2 мкМ PHMB в течение 48 и 24 часов соответственно. (a и c) Необработанные контроли (слева) демонстрируют нормальную удлиненную морфологию промастигот с интактным и четким отличным кинетопластом (кДНК), N, митохондрией (M), липидными вакуолями (LV) и гликозомой (G). (e-h) Изображения световой микроскопии, показывающие морфологические и поведенческие изменения (отсутствие образования зажимов, как указано стрелками) после обработки 2 мкМ PHMB в течение 24 часов. Масштабные линейки = (а) 1,1 мкм, (б) 0,6 мкм, (в и г) 0.25 мкм, (e и f) 7,5 мкм и (g и h) 25 мкм.


Таблица 1. Антилейшманиальные и цитотоксические эффекты полиплексов PHMB и PHMB / ДНК.

Таблицы показывают антилейшманиальную эффективность, цитотоксичность и селективность соединений. Показаны значения IC 50 и / или индекс селективности (SI) соединений по сравнению со стандартными антилейшманиозными лекарственными средствами. Табличные значения представляют собой средние значения IC 50 из 3–6 независимых экспериментов для каждого соединения.IC 50 = минимальная концентрация веществ, необходимая для уничтожения 50% населения; SI = среднее IC 50 против BMDM / среднее IC 50 против L . основных амастигот; ND = не определено.


Чтобы определить уровень избирательности PHMB в отношении патогена / хозяина, мы измерили его цитотоксичность в отношении первичных макрофагов костного мозга (BMDM), кератиноцитов и эпителиального эпителия 293T. клеток с помощью анализа AlamarBlue.Полученные значения IC 50 показывают, что PHMB примерно в 6,5 раз более токсичен в отношении BMDM (IC 50 = 4 мкМ), чем эпителиальные клетки 293T (IC 50 = 26 мкМ). Более того, PHMB убил 50% кератиноцитов в концентрации 6,6 ± 3,5 мкМ. Результаты показывают, что кератиноциты более чувствительны к PHMB по сравнению с эпителиальными клетками 293T, но менее чувствительны, чем BMDM. Хотя PHMB в настоящее время безопасно используется для нескольких целей в клиниках и на производстве, наши результаты показали, что PHMB имеет плохую селективность между амастиготами и BMDM с индексом селективности 1 (таблица 1).Конечно, важно учитывать, что эти значения относятся к клеткам, выращенным в культуре.

Ободрен эффективностью PHMB против L . основных промастигот, мы исследовали лежащие в основе его механизмы действия. Литературные исследования показали, что микробная избирательная токсичность PHMB обусловлена ​​преимущественным разрушением микробных мембран по сравнению с мембранами млекопитающих [38,39]; считается, что он специфически взаимодействует с кислыми фосфолипидами микробных патогенов, в то время как нейтральные фосфолипиды в мембранах клеток млекопитающих затрагиваются лишь незначительно [38,40].Мы предположили, что PHMB также убивает L . основных паразитов с помощью этого механизма и протестировали влияние PHMB на целостность мембран промастигот с использованием пропидия йодида (PI), красителя, который может проникать в паразита и окрашивать ДНК только после потери целостности мембраны. После инкубации промастиготов с 2 мкМ PHMB в течение 30 минут более 20% популяции паразитов было окрашено PI, и окрашивание увеличивалось в более поздние моменты времени (рис. 2A). Мы повторили анализ исключения красителя с использованием красителя YO-PRO-1 в соответствии с инструкциями производителя, и результаты показали аналогичную зависящую от времени проницаемость (рис. 2В).Следовательно, PHMB повреждает целостность мембран паразитов в зависимости от времени, и проницаемые паразиты наблюдались в течение 30 минут, что подтверждает гипотезу о том, что PHMB разрушает мембраны паразитов.

Рис. 2. Механизм (ы) действия PHMB на L . основных промастигот.

PHMB нарушил целостность мембраны и конденсировал ДНК в L . основных промастигот. Типичная гистограмма FACS (а) йодид пропидия (PI) и (b) окрашивание промастигот красителем YO-PRO-1 после обработки 2 мкМ PHMB в указанные моменты времени, демонстрируя зависящее от времени влияние PHMB на целостность мембраны.Убитые нагреванием промастиготы и амфотерицин B в концентрации 2 мкМ использовали в качестве положительного контроля. (c) Анализ с помощью флуоресцентной микроскопии, показывающий конденсированные и поврежденные материалы ДНК L . основных промастигот после обработки PHMB в концентрации 2 мкМ в течение 48 часов по сравнению с имитационным контролем (дистиллированная вода). Масштабные линейки = 5 мкм.


Во время анализа ультраструктуры с помощью ПЭМ мы постоянно наблюдали конденсацию ядер паразитов после инкубации с 2 мкМ PHMB в течение 24─48 часов (рис. 1).Более того, механизм бактерицидного действия PHMB был связан с его сильным и кооперативным взаимодействием с нуклеиновыми кислотами in vitro [41]. Это привело нас к мысли, что механизм (ы) уничтожения паразитов PHMB может также включать связывание с ДНК внутри паразитов. Чтобы проверить эту возможность, промастиготы обрабатывали 2 мкМ PHMB в течение 48 часов, окрашивали Hoechst 33342 и исследовали с помощью конфокальной и флуоресцентной микроскопии. Результаты показали, что PHMB связывает, конденсирует и разрушает структуры хромосом (рис. 2C).Эта интерпретация клеточных эффектов потребует проникновения полимера в паразитов, а также прочного связывания PHMB с геномной ДНК паразита (гДНК). Для проверки проникновения паразитов, L . основных промастиготов инкубировали с производным PHMB, ковалентно помеченным флуоресцеинизотиоцианатом (FITC) в концентрации 0,35 мкМ (суб-IC 50 ). Результаты подтверждают, что паразиты поглощают PHMB-FITC, и полимер распределяется по ядрам, где он может взаимодействовать с хромосомами (рис. 3A).Для проверки связывания хромосом мы использовали выделенную геномную ДНК (гДНК) из L . major и анализ сдвига электрофоретической подвижности (EMSA). Четкое замедление миграции подтвердило, что PHMB и гДНК образуют полиплексы при относительном весовом соотношении ≥ 0,25 и, таким образом, могут также связывать хромосомную ДНК внутри паразитов (рис. 4A).

Рис. 3. Клеточная локализация PHMB-FITC в промастиготах и ​​BMDM.

Конфокальные изображения, показывающие поглощение PHMB-FITC (а) промастаготами и (б) BMDM.Обратите внимание на очевидное ядерное исключение в клетках BMDM, но не у паразитов, масштабная линейка = 10 мкм.


Рис. 4. Взаимодействие PHMB / ДНК и физико-химическая характеристика полиплексов.

Образование полиплексов PHMB / ДНК подтверждено 1% -ным агарозным гелем, ПЭМ и изменением цвета. (a) Полиплексы PHMB / gDNA, (b) ТЕМ-изображение, показывающее образование полиплексов PHMB / CpG ODN при соотношении 2: 1, (c) полиплексы PHMB / CpG ODN, (d) временное изменение мутности во время комплексообразования PHMB / CpG ODN, (e ) Полиплексы PHMB / CpG-R и (f) тот же гель (e) с измерением флуоресценции CpG-R.За исключением отрицательного контроля и одного только PHMB, все лунки содержали равные количества (вес) ДНК с различными концентрациями PHMB. М представляет собой 2-логарифмическую лестницу ДНК (0,1-10,0 т.п.н., New England Biolabs), а N представляет воду, используемую в качестве отрицательного контроля. Все указанные отношения PHMB / ДНК даны в относительной массе (мас. / Мас.). Указывает на полиплексы PHMB / CpG ODN двухмесячной давности. Масштабная линейка = 300 нм.


Далее мы рассмотрели, как PHMB избирательно конденсирует или разрушает хромосомы паразитов, не затрагивая ДНК хозяина.Чтобы исследовать клеточную локализацию (и) PHMB, мы использовали его флуоресцентную версию (PHMB-FITC). Клетки BMDM инкубировали с 1 мкМ PHMB-FITC, контрастировали с помощью Hoechst 33342 и исследовали интернализацию с использованием флуоресцентной и конфокальной лазерной сканирующей микроскопии. Данные показывают, что PHMB легко проникает в BMDM, но локализуется в цитоплазме без видимого входа в ядра в клетках млекопитающих, указывая на неспособность проходить через ядерную оболочку (Рис. 3B). Следовательно, внутриклеточная локализация PHMB, по-видимому, отличается у BMDM и паразитов, и PHMB получает доступ к хромосомам паразита, но не к хромосомам макрофагов хозяина.

PHMB представляет собой новый невирусный носитель олигонуклеотидов CpG

Два основных наблюдения побудили нас предположить, что PHMB в комбинации с иммуномодулирующими нуклеиновыми кислотами может использоваться в качестве параллельного уничтожения внутриклеточного L , направляемого хозяином и патогеном. майор . Изначально мы знали, что он связывает геномную ДНК L . основных паразитов, образующих комплексы PHMB / гДНК. Более того, PHMB использовался в качестве носителя трансфекции siRNA в гибридной форме с оксидом железа [42].Чтобы проверить, можно ли улучшить доставку нуклеиновой кислоты с помощью PHMB, CpG ODN был выбран в качестве модели иммуномодулирующей молекулы нуклеиновой кислоты. CpG ODN — мощный иммуномодулятор, который активирует макрофаги и дендритные клетки, чтобы убить внутриклеточный L . основных паразитов [43]. Мы пришли к выводу, что комбинации PHMB и CpG ODN могут потенциально убивать паразитов напрямую через паразитарные мембраны и нарушение хромосом и косвенно через модуляцию иммунитета хозяина. В случае успеха такие двойные эффекты, направленные на хозяина и патогены, могут улучшить потенцию.В этом контексте был приготовлен и охарактеризован ряд составов полиплексов PHMB / CpG ODN, их биоактивность была оценена и сравнена со свободными компонентами.

Прежде чем оценивать потенциальное использование PHMB в качестве безопасного и эффективного носителя для нуклеиновых кислот, мы сначала хотели проверить, связывает ли PHMB CpG ODN с образованием стабильных нанокомплексов. Результаты ПЭМ показали, что существует комплексообразование между PHMB и CpG ODN при соотношении 2: 1 (фиг. 4B). Наши эксперименты с EMSA показали, что PHMB замедляет подвижность CpG ODN при относительных весовых соотношениях ≥ 0.25 (Рис. 4C). После добавления избытка PHMB к CpG ODN мы также наблюдали мгновенную реакцию, которая превращала бесцветный PHMB и CpG ODN в растворе во временный молочный вид, что свидетельствует об электростатических взаимодействиях между PHMB и CpG ODN и образовании комплекса (рис. 4D). В соответствии с образованием комплекса ODN в присутствии PHMB обнаруживал задержку миграции при анализе с помощью EMSA. Чтобы более четко визуализировать изменения подвижности олигонуклеотидов, тот же CpG ODN был помечен родаминовым красным на 3’-концах (CpG-R), и результаты подтвердили замедленную электрофоретическую подвижность и удержание CpG ODN в лунках (рис. 4E и 4F).

Затем мы охарактеризовали размер и поверхностный заряд комплексов с помощью DLS и ELS. Эти анализы выявили частицы с высокой воспроизводимостью размеров: 310,9 ± 30,5 нм и 285,3 ± 15,0 нм при относительных весовых соотношениях 2: 1 и 1: 1, соответственно (таблица 2). Значения PDI полиплексов были менее 0,3, что указывает на узкое распределение по размерам. Чтобы оценить стабильность полиплексов, их дзета-потенциал измеряли с помощью ELS и обнаружили, что он составляет + 33,3 ± 1,1 мВ (соотношение 2: 1) и –18,77 ± 0.4 мВ (соотношение 1: 1) и зависит от выбранного соотношения PHMB и CpG ODN (таблица 3). Как и ожидалось, более высокие отношения PHMB к CpG ODN приводили к полиплексам с более высокими положительными относительными дзета-потенциалами. Данные показывают, что комплексы PHMB / CpG ODN умеренно стабильны при соотношении 2: 1, тогда как они могут быть нестабильными при соотношении 1: 1. Для оценки стабильности с течением времени получали полиуплексы PHMB / CpG ODN и хранили при 4 ° ° C в течение двух месяцев, прежде чем их физико-химическая природа была снова охарактеризована с помощью ТЕМ и EMSA.Были получены аналогичные результаты и, таким образом, подтверждена стабильность полиплексов с течением времени при соотношении 2: 1 (фиг. 4B и 4C обозначены знаком ®). Чтобы количественно оценить силу и специфичность взаимодействий между двумя молекулами, мы использовали изотермическую калориметрию титрования (ITC). Результаты показывают, что PHMB может сильно взаимодействовать с CpG ODN с образованием полиплексов, подтверждая его аффинность связывания с ДНК. Подробные термодинамические параметры указывают на последовательное связывание между PHMB и CpG ODN (рис. 5).Данные ITC показывают, что энтальпия реакции связывания PHMB / CpG ODN была изначально экзотермической (-18,37 ккал / моль), что указывает на сильное электростатическое взаимодействие между отрицательно заряженной фосфатной основной цепью CpG ODN и катионным заряженным полимером PHMB. Экзотермические сигналы уменьшались в ходе титрования и, как было обнаружено, выходили на плато при молярном соотношении 1: 1 обоих партнеров по связыванию. Наконец, результаты ПЭМ также подтверждают образование нанополиплексов между PHMB и CpG ODN и, кроме того, предполагают преимущественно сферическую морфологию полиплексов, а не цилиндрическую или стержневую форму (рис. 4B).Взятые вместе, результаты подтвердили, что существует сильное электростатическое взаимодействие между PHMB и CpG ODN, которое приводит к образованию умеренно стабильных полиплексных наночастиц.

Рис. 5. Физико-химические характеристики нанополиплексов PHMB / CpG ODN.

На рисунках показаны количественные измерения силы взаимодействия между CpG ODN и PHMB посредством ITC с соответствующими термодинамическими параметрами: сродство связывания ( K a ), изменения энтальпии (Δ H ) и изменения энтропии (Δ S ).(a) Исходные данные, созданные ITC, (b) и (c) проанализировали данные ITC с использованием двух инструментов анализа данных и построения графиков: Origin и SigmaPlot, соответственно.


Таблица 2. Dynasore спасает убитых человек L . основных амастигот внутри макрофагов.

Dynasore ингибировал уничтожение внутриклеточного L . основных амастигот и промастигот полиплексами PHMB или PHMB / CpG ODN.Значения представляют собой среднее значение двух независимых экспериментов, и значения даны как среднее ± стандартная ошибка. Приведенные значения концентраций относятся к PHMB внутри полиплексов.


Таблица 3. Физико-химические характеристики нанополиплексов PHMB / CpG ODN.

В таблице показано определение размера частиц и дзета-потенциала с использованием DLS и ELS с их PDI. В таблице приведены результаты трех независимых экспериментов.Распределение по размерам и измерения дзета-потенциала проводили с использованием воды Millipore и воды ISA (0,15 М KCl), соответственно.


Затем мы проверили возможность использования PHMB в качестве безопасного и эффективного средства доставки для CpG ODN. Мы охарактеризовали полиплексы путем измерения эффективности захвата, цитотоксичности, антипаразитарной эффективности и их иммуномодулирующей активности по отношению к свободным компонентам. Эффективность захвата CpG-R в полиплексной форме была увеличена примерно в 15 раз по сравнению с свободной формой, в то время как поглощение PHMB в виде полиплекса не увеличилось, подтверждая, что PHMB может доставлять молекулы ДНК в макрофаги (рис. 6).Поскольку включение PHMB и CpG в конденсаты полиплексов может подавлять среднюю флуоресценцию PHMB-FITC или CpG-R, эти измерения поглощения могут недооценивать доставку. Чтобы узнать больше о механизме проникновения, мы исследовали их свойства поглощения макрофагами. Результаты конфокальной микроскопии и проточной цитометрии показали, что PHMB-FITC легко поглощается макрофагами в зависимости от времени (рис. 3B и 6A). Напротив, когда PHMB-FITC инкубировали с BMDM при 4 ° C в эквивалентных условиях культивирования клеток, поглощение было сильно снижено (87%) (рис. 7A), что указывает на то, что преобладающий механизм поглощения PHMB-FITC BMDM составляет через энергозависимый режим, который, вероятно, является эндоцитозом.Для идентификации специфических путей эндоцитоза использовался широкий спектр селективных ингибиторов эндоцитоза [32]. Вкратце: мы использовали: 1) вортманнин, мощный ингибитор фосфатидилинозитолкиназы (PI3K), который обычно используется в качестве ингибитора макропиноцитоза, 2) цитохалазин D, который блокирует полимеризацию актина и обычно используется в качестве ингибитора фагоцитоза, 3) диназорез. , ингибитор динамин-зависимого эндоцитоза, 4) хлорпромазина гидрохлорид, который ингибирует Rho GTPase, которая необходима для образования везикул, покрытых клатрином, при клатрин-зависимом эндоцитозе, и 5) икаругамицин, ингибитор ямочного эндоцитоза, покрытого клатрином .Клетки предварительно инкубировали со специфическими ингибиторами эндоцитоза в течение 30 минут перед воздействием PHMB-FITC, полиплексов, декстрана или трансферрина с последующей инкубацией при 4 ° C или 37 ° C в течение 4 часов. Результаты показывают, что только dynasore, проницаемая для клеток небольшая молекула, которая ингибирует активность динамин-GTPase, необходимую для динамин-зависимого эндоцитоза, эффективно ингибирует поглощение PHMB-FITC (ингибирование 80%) (фиг. 7A). Сходные результаты были получены для полиплексов PHMB-FITC / CpG ODN и PHMB / CpG-R (фиг. 7B и S3), предполагая, что пути поглощения PHMB BMDM не зависят от процессов образования полиплексов.Однако декстран и трансферрин эффективно ингибировались цитохалазином D и хлорпромазина гидрохлоридом, но не диназором. Взятые вместе, результаты показывают, что механизмы захвата PHMB-FITC и его полиплексов преимущественно связаны с через динамин-зависимый эндоцитоз.

Рис. 6. Поглощение клетками PHMB и CpG ODN и их полиплексов BMDM.

Наложенные гистограммы показывают зависящее от времени поглощение (а) полиплексов PHMB-FITC и (б) PHMB-FITC / CpG ODN макрофагами.Тогда как (c) показывает поглощение CpG-R BMDM в виде полиплексной формы по сравнению с его свободной формой. Гистограммы представляют три независимых эксперимента.


Рис. 7. Поглощение клетками полиплексов PHMB-FITC и PHMB-FITC / CpG ODN и эффекты селективных ингибиторов эндоцитоза.

Гистограммы показывают влияние различных ингибиторов и температуры на клеточное поглощение (a) PHMB-FITC, (b) полиплексов PHMB-FITC / CpG ODN, (c) декстрана / FITC, используемых в качестве положительного контроля, чтобы исключить влияние FITC, который может мешать клеточным механизмам поглощения PHMB и (d) алекса-448-меченного трансферрина, используемого в качестве положительного контроля для клатрин-зависимого эндоцитоза.Показаны нормализованные значения MFI трех независимых экспериментов по проточной цитометрии, и значения даны как среднее ± стандартная ошибка.


Затем мы оценили цитотоксичность в отношении клеток-хозяев. Неожиданно результаты показали, что значения IC 50 полиплексов были намного выше (50 ± 10,4 4 мкМ и 33 ± 9,54 мкМ при соотношениях 1: 1 и 2: 1, соответственно) в отношении BMDM, чем для одного PHMB. Точно так же токсичность полиплексов PHMB / CpG ODN показала гораздо более высокие значения IC 50 (185 ± 22.5 и 90,3 ± 23,5 при соотношении 1: 1 и 2: 1 соответственно) против эпителиальных клеток 293T, чем только PHMB. Результаты показывают, что полиплексы имеют резко сниженную токсичность в отношении клеток-хозяев по сравнению со свободным PHMB. Аналогичным образом мы проверили цитотоксичность полиплексов против L . основных промастигот , и результаты показывают более низкую эффективность по сравнению со свободным PHMB, а только CpG ODN не проявляет активности (Таблица 1). Катионная природа полимеров (более высокий положительный дзета-потенциал) часто связана с токсичностью по отношению к клеткам-хозяевам, и ожидается, что декатионизация снизит токсичность [44].Как и ожидалось, токсичность полиплексов против клеток BMDM и 293T возрастала по мере увеличения относительного массового отношения PHMB: CpG ODN (таблица 1). Эти результаты согласуются с нашими данными о дзета-потенциале, показывающими, что увеличение соотношений PHMB / CpG ODN увеличивает положительный заряд полиплекса (таблица 3).

Затем мы определили лейшманицидные эффекты PHMB и CpG ODN в полиплексной и свободной формах с использованием BMDM, инфицированного трансгенной люциферазой L . мажорный штамм .Полиплексы проявляли повышенную антилейшманиозную активность против внутриклеточных амастигот при многократном увеличении селективности (таблица 1). Мы предположили, что усиление антилейшманиозной активности было связано с увеличением доставки клеток-хозяев. Если бы это было так, то блокирование пути поглощения с использованием dynasore подавило бы внутриклеточное уничтожение амастигот PHMB. Соответственно, мы определили эффективность PHMB или его полиплексов против внутриклеточных амастигот в присутствии / отсутствии диназора.Результаты ясно показывают, что dynasore ингибирует PHMB-опосредованное уничтожение амастигот (таблица 2). В присутствии диназора (80 мкМ) значение IC 50 PHMB против внутриклеточных амастигот увеличивалось в два раза, и полиплексы были полностью неактивными до максимальной испытанной дозы (14,2 мкМ) по сравнению с полиплексами без диназора ( 1–2,28 мкМ). Точно так же dynasore подавлял антилейшманиальные эффекты PHMB и полиплексов против промастиготов. Чтобы узнать больше о влиянии dynasore на PHMB-опосредованное уничтожение промастиготов, мы исследовали механизм, с помощью которого промастиготы поглощают PHMB.Мы использовали суб-IC 50 доз PHMB-FITC (0,35 мкМ) и те же ингибиторы, которые использовались ранее с BMDM. Неожиданно результаты показали, что dynasore ингибировал поглощение PHMB-FITC промастиготами более чем на 98%, в то время как другие ингибиторы существенно не влияли на поглощение (S4 фиг.). Сам по себе Dynasore не проявлял цитотоксичности ни в отношении амастигот, ни в отношении промастигот (таблица 2). Таким образом, dynasore спас паразитов от внутриклеточного антилейшманиального действия PHMB, блокируя захват полимера макрофагами, что еще раз подтвердило его внутриклеточный убивающий потенциал, что согласуется с нашими доказательствами механизма действия на уровне ДНК.Более того, результаты показывают, что dynasore также блокирует поглощение PHMB промастиготами и, следовательно, снижает антилейшманиозные эффекты. Взятые вместе, результаты предполагают, что PHMB является эффективным антилейшманиальным соединением и средством, способствующим проникновению нуклеиновых кислот в терапию, направленную на хозяина и патогены.

Наконец, чтобы оценить, обладает ли PHMB иммуномодулирующими свойствами и влияет ли образование полиплексов на иммуномодулирующие свойства CpG ODN, концентрации нескольких ключевых цитокинов были измерены с помощью иммуноферментного анализа (ELISA), взятого из супернатантов совместно культивируемых BMDM.Для свободных CpG ODN продукция всех тестируемых цитокинов увеличивалась с увеличением доз (фиг. 8). Нам не удалось получить надежные измерения IL-4 и TNF-α в клетках, обработанных полиплексами или свободными компонентами (таблица S2). Мы также наблюдали, что один PHMB стимулировал выработку провоспалительных цитокинов, таких как IL-6, IL-10 и IL-12, путем активации макрофагов (S5 фиг.). Более того, на основании измерений IL-6, IL-12 и IL-10 полиплексы обычно проявляли более высокую способность к иммунной стимуляции по сравнению со свободным CpG ODN.Это говорит о том, что компоненты полиплекса являются биоактивными после доставки в BMDM; другими словами, PHMB должен высвобождать CpG ODN из полиплексов внутри BMDM.

Рис. 8. Влияние полиплексов CpG ODN и PHMB / CpG ODN на продукцию цитокинов BMDM.

Гистограммы показывают уровни продукции (ab) IL-6, (cd) IL-10 и (ef) IL-12 после добавления полиплексов CpG ODN или PHMB / CpG ODN к BMDM, которые были предварительно активированы CpG ODN (15 мкг / мл) в течение 30 мин и дополнительно инкубировали в течение 48 ч.Контроли представляли собой клетки без какой-либо предварительной стимуляции, а дозы 0 мкМ представляли собой клетки, предварительно стимулированные CpG ODN, но без какой-либо дополнительной стимуляции CpG ODN или комплексом. Концентрации, указанные для полиплексов, представляют собой дозу PHMB, а концентрации CpG ODN составляют половину указанных доз. Планки погрешностей показывают стандартные ошибки трех независимых экспериментов.



Терапия лейшманиоза основывается только на нескольких химиотерапевтических средствах, все из которых не обладают соответствующей эффективностью, безопасностью и доступностью.Многие лекарства, используемые в качестве противопаразитарных средств, были перенесены из других областей болезней [14], и эта стратегия кажется подходящей для лечения лейшманиоза, когда требуется очень низкая стоимость товаров. Здесь мы демонстрируем, что давно зарекомендовавший себя антимикробный полимер PHMB является мощным антилейшманиозным кандидатным лекарственным средством для местного применения против CL. PHMB более эффективен, чем существующие стандартные антилейшманиальные препараты in vitro , и может обеспечить дополнительные преимущества за счет заживления ран, иммуномодуляции и доставки дополнительных лекарств в клетки.

PHMB — это очень недорогое соединение (около 10-50 долларов / кг), которое широко используется в клиниках, домах и в промышленности в качестве дезинфицирующего и антисептического средства с отличной переносимостью более 50 лет во всем мире [40,45–47]. Он имеет солидные показатели безопасности и широко считается полезным при лечении ран [29,48]. Как типично для катионных полимеров, токсичность для клеток наблюдается при высоких концентрациях. Было обнаружено, что токсичность PHMB была неожиданно высокой в ​​отношении BMDM, но значительно снижалась при комплексировании с ODN, предположительно из-за образования комплекса / экранирования заряда, при сохранении антилейшманиальных эффектов (таблица 1).Таким образом, PHMB может быть изменен и потенциально использован в качестве эффективного местного лекарственного средства против CL после соответствующих клинических испытаний, а образование комплекса с иммуномодулирующими олигонуклеотидами CpG может обеспечить дополнительные преимущества.

Наши результаты показывают, что PHMB напрямую убивает паразитов посредством двойного механизма, включающего как проницаемость мембран паразитов, так и избирательную конденсацию и разрушение хромосом паразитов. Недавно было показано, что PHMB легко проникает в различные виды бактерий и убивает посредством хромосомной конденсации (Chindera et al., Отправлено). Точно так же наши результаты показывают, что PHMB конденсирует или повреждает хромосомы паразита, но не проникает в ядра макрофагов. Таким образом, открытие помогает объяснить, как PHMB убивает паразитов без аналогичного повреждения клеток-хозяев.

Успешная химиотерапия инфекционных заболеваний, вызванных внутриклеточными возбудителями, в т.ч. L . major , включает модуляцию иммунитета хозяина для лечения, направляемого хозяином. Было показано, что рекомендованные антилейшманиозные препараты обладают иммуномодулирующими свойствами и частично оказывают свое действие через иммуномодуляцию хозяина [49,50].Таким образом, комбинированная терапия, включающая компоненты, которые могут непосредственно убивать патоген, а также активировать иммунную систему хозяина, является привлекательной. Нуклеиновые кислоты, такие как CpG ODN, потенциально могут применяться как в качестве адъювантов, так и в качестве неспецифических иммуномодуляторов, вызывая иммунитет против внутриклеточных патогенов, таких как L . основной [43]. Они также открывают большие перспективы для лечения многих заболеваний в качестве медиаторов подавления РНК и вакцинации. Однако их медицинское применение серьезно затруднено из-за их нестабильности в биологических жидкостях и плохого клеточного поглощения [51].Кроме того, ключевой задачей является эффективная и безопасная доставка иммуномодуляторов на основе нуклеиновых кислот. Комплексирование нуклеиновых кислот с клинически совместимыми полимерами с образованием наночастиц может преодолеть проблемы доставки за счет улучшения прохождения через физиологические или клеточные барьеры. В контексте терапии, направленной на хозяина и патоген, мы исследовали потенциал доставки нуклеиновых кислот PHMB, а также общий синергетический эффект комбинированной терапии, включающей комплексы PHMB и CpG ODN против CL.PHMB и CpG ODN образуют самособирающиеся наноструктуры, которые легко захватываются макрофагами, повышая эффективность поглощения нуклеиновых кислот и повышая эффективность и селективность PHMB против паразитов. В принципе, полиплексный состав может улучшить доставку и обеспечить замедленное высвобождение.

Потенциальные антилейшманиальные эффекты PHMB имеют три аспекта. Во-первых, он может ускорить закрытие раны, тем самым улучшая косметический результат ХЛ и предотвращая вторичные бактериальные и / или грибковые инфекции, которые часто задерживают заживление ран у пациентов с ХЛ [52].Во-вторых, он может напрямую убивать паразитов, вызывающих поражения. В-третьих, антилейшманиозным эффектам PHMB может дополнительно способствовать его способность доставлять иммуномодулирующие агенты, такие как CpG ODN. Открытие взаимодействий PHMB с нуклеиновой кислотой и формирование нанополиплексов для эффективной доставки в макрофаги может иметь широкое применение, выходящее за рамки первоначальных целей этого исследования, включая терапию других внутриклеточных патогенов или неинфекционных заболеваний.

Дополнительная информация

S3 Рис.Доставка CpG ODN в макрофаги с помощью PHMB.

Потенциал клеточного поглощения полиплексов (a) PHMB / CpG-R и (b) PHMB-FITC / CpG ODN и ингибирование dynasore. Свободные полиплексы PHMB-FITC, PHMB-FITC / CpG ODN и PHMB / CpG-R эффективно блокировались dynasore. На основании их MFI поглощение CpG-R было увеличено примерно в 15 раз в виде полиплексной формы по сравнению с его свободной формой.



S4 Рис. Поглощение PHMB-FITC промастиготами и эффекты селективных ингибиторов эндоцитоза.

Гистограммы показывают влияние различных ингибиторов на блокирование поглощения PHMB-FITC промастиготами. Нормализованные значения средней интенсивности флуоресценции (MFI) трех независимых экспериментов проточной цитометрии изображены как среднее ± стандартная ошибка.



S2 Стол. Измерения продукции IL-4 и TNF-α.

Расчетные концентрации продукции (a) IL-4 и (b) TNF-α в нг / мл после обработки PHMB (строки 3 и 4), CpG ODN (строки 5 и 6) или полиплексов PHMB / CpG ODN (строки 7 и 8) при разных концентрациях.Строки 1 и 2 представляют собой серийно разведенные (1: 1) стандарты. Строки 9A и 10A — контрольные.




Авторы благодарны профессору д-ру Ричарду Люциусу, специалисту по молекулярной паразитологии, Университет Гумбольдта, Берлин, за его научную поддержку. Благодарим профессора д-ра Георга Кроне, Даниэлу Бунзен и Клаудию Гериг, биоцентр Университета Вюрцбурга, основной блок электронной микроскопии, за их помощь в подготовке образцов и визуализации для ПЭМ.Мы также благодарим Елену Кацович, Институт биологии молекулярных инфекций, Вюрцбургский университет, за техническую помощь.

Вклад авторов

Задумал и спроектировал эксперименты: RF LG HM LM TAO. Проведены эксперименты: RF MCA KC MS BR NH TL NFK. Проанализированы данные: РФ МКА БР ЛГ. Предоставленные реагенты / материалы / инструменты анализа: RF LG HM LM TAO. Написал статью: РФ LG HM LM TAO TL NH NFK.

Список литературы

  1. 1. Цой CM, Лернер Э.А.Лейшманиоз как развивающаяся инфекция. J Investigate Dermatol Symp Proc. 2001; 6: 175–82. pmid: 11924824
  2. 2. Всемирная организация здравоохранения. Серия технических отчетов по борьбе с лейшманиозами. Женева, 22–26 марта. 2010; 949: 1–187.
  3. 3. Morizot G, Kendjo E, Mouri O, Thellier M, Pérignon A, Foulet F и др. Путешественники с кожным лейшманиозом излечиваются без системной терапии. Clin Infect Dis. 2013; 57: 370–80. pmid: 23633111
  4. 4. Эйрас Д.П., Киркман Л.А., М.Х., Дэниел П.Эйрас, Лаура А. Киркман HWM. Кожный лейшманиоз: современные методы лечения в США возвращающихся путешественников. Варианты лечения Curr Infect Dis. 2015; 7: 52–62. pmid: 25788870
  5. 5. Локвуд Д. Солдаты сражаются с «Багдадским кипением». Nat Med. 2004. 10: 110–110.
  6. 6. Альвар Дж., Велес И.Д., Берн С., Эрреро М., Дежо П., Кано Дж. И др. Лейшманиоз во всем мире и глобальные оценки его заболеваемости. PLoS One. 2012; 7: e35671. pmid: 22693548
  7. 7. Хартли М.А., Дрекслер С., Ронет С., Беверли С.М., Фазель Н.Иммунологические, экологические и филогенетические виновники метастатического лейшманиоза. Trends Parasitol. 2014; 30: 412–22. pmid: 24954794
  8. 8. МакКолл Л-И, МакКерроу Дж. Х. Детерминанты фенотипа заболевания у трипаносоматидных паразитов. Trends Parasitol. 2014; 30: 342–9. pmid: 24946952
  9. 9. Hurdayal R, Brombacher F. Роль IL-4 и IL-13 в кожном лейшманиозе. Immunol Lett. 2014; 161: 179–83. pmid: 24412597
  10. 10. Гонсалес-Леаль И.Дж., Рёгер Б., Шварц А., Ширмейстер Т., Райнхекель Т., Лутц МБ и др.Катепсин B в антигенпрезентирующих клетках контролирует медиаторы иммунного ответа Th2 во время инфекции Leishmania major . PLoS Negl Trop Dis. 2014; 8: e3194. pmid: 25255101
  11. 11. Schamber-Reis BLF, Petritus PM, Caetano BC, Martinez ER, Okuda K, Golenbock D, et al. UNC93B1 и Toll-подобные рецепторы, чувствительные к нуклеиновым кислотам, опосредуют устойчивость хозяина к инфекции Leishmania major. J Biol Chem. 2013; 288: 7127–36. pmid: 23325805
  12. 12. Momeni AA, Rasoolian M, Navaei A, Emami S, Shaker Z, Mohebali M и др.Разработка липосом с антилейшманиозными препаратами для лечения кожного лейшманиоза. J Liposome Res. 2013; 23: 134–44. pmid: 23350940
  13. 13. Сундар С., Чакраварти Дж. Лейшманиоз: обновление текущей фармакотерапии. Эксперт Opin Pharmacother. 2013; 14: 53–63. pmid: 23256501
  14. 14. Эндрюс К.Т., Фишер Г., Скиннер-Адамс Т.С. Перепрофилирование лекарств и паразитарные простейшие болезни человека. Int J Parasitol Drugs Drug Resist. 2014; 4: 95–111. pmid: 25057459
  15. 15.Монж-Майо Б., Лопес-Велес Р. Терапевтические возможности для кожного лейшманиоза старого мира и кожного и слизисто-кожного лейшманиоза нового мира. Наркотики. 2013; 73: 1889–920. pmid: 24170665
  16. 16. Фон Стебут Э. Лейшманиоз. JDDG J der Dtsch Dermatologischen Gesellschaft. 2015; 13: 191–201.
  17. 17. Бейли MS. Комментарий редакции: местные методы лечения кожного лейшманиоза. Clin Infect Dis. 2013; 57: 381–3. pmid: 23633110
  18. 18. Морено Э., Шварц Дж., Фернандес К., Санмартин С., Нгуева П., Ираче Дж. М. и др.Наночастицы как многофункциональные устройства для местного лечения кожного лейшманиоза. Мнение эксперта Drug Deliv. 2014; 11: 579–97. pmid: 24620861
  19. 19. Бен Салах А., Бен Мессауд Н., Гедри Э., Заатур А., Бен Алайя Н., Беттаиб Дж. И др. Паромомицин для местного применения с гентамицином или без него при кожном лейшманиозе. N Engl J Med. 2013; 368: 524–32. pmid: 23388004
  20. 20. Карнейро Дж., Сантос Д.С., Оливейра М.К., Фернандес А.П., Феррейра Л.С., Рамальдес Г.А. и др. Местная доставка и антилейшманиальная активность in vivo липосом, нагруженных паромомицином, для лечения кожного лейшманиоза.J Liposome Res. 2010; 20: 16–23. pmid: 19530897
  21. 21. Карнейро Дж., Агияр М.Г., Фернандес А.П., Феррейра ЛАМ. Системы доставки лекарств для местного лечения кожного лейшманиоза. Мнение эксперта Drug Deliv. 2012; 9: 1083–97. pmid: 22724539
  22. 22. Джаббур М.Н., Исса Дж., Чарафеддин К., Симан Й., Карам М., Халифе Х. и др. Иммунная микросреда при кожном лейшманиозе. J Eur Acad Dermatol Venereol. 2014.
  23. 23. Гупта С., Сане С.А., Шакья Н., Вишвакарма П., Хак В.CpG-олигодезоксинуклеотид 2006 и милтефозин, потенциальная комбинация для лечения экспериментального висцерального лейшманиоза. Антимикробные агенты Chemother. 2011; 55: 3461–4. pmid: 21537026
  24. 24. Лима-Джуниор Д.С., Коста Д.Л., Каррегаро В., Кунья Л.Д., Сильва АЛН, Минео TWP и др. Продукция IL-1β, производная инфламмасом, вызывает опосредованную оксидом азота устойчивость к Leishmania. Nat Med. 2013; 19: 909–15. pmid: 23749230
  25. 25. Датта Н., Мукерджи С., Дас Л., Дас ПК. Нацеливание на иммуностимулирующую ДНК излечивает экспериментальный висцеральный лейшманиоз за счет активации оксида азота и активации Т-клеток.Eur J Immunol. 2003. 33: 1508–18. pmid: 12778468
  26. 26. Ямамото М., Сато Т., Берен Дж., Вертели Д., Клинман Д.М. Ускорение заживления ран у приматов путем местного введения иммуностимулирующих CpG-олигонуклеотидов. Биоматериалы. 2011; 32: 4238–42. pmid: 21421264
  27. 27. Сато Т., Ямамото М., Симосато Т., Клинман Д.М. Ускоренное заживление ран, опосредованное активацией Toll-подобного рецептора 9. Восстановление заживления ран. 2010; 18: 586–93. pmid: 20946144
  28. 28.Аревало I, Туллиано Дж., Киспе А., Спет Дж., Матлашевски Дж., Льянос-Куентас А. и др. Роль имиквимода и парентерального антимониата меглумина в начальном лечении кожного лейшманиоза. Clin Infect Dis. 2007. 44: 1549–1554. pmid: 17516397
  29. 29. Герит Д. Малдер, Джозеф П. Каворси DKL. Полигексаметилен бигуанид (PHMB): дополнение к текущим противомикробным препаратам для местного применения. Раны ,. 2007. 19: 173–182.
  30. 30. Самал С.К., Даш М., Ван Влиерберг С., Каплан Д.Л., Кьеллини Е., ван Блиттерсвейк С. и др.Катионные полимеры и их терапевтический потенциал. Chem Soc Rev.2012; 41: 7147–94. pmid: 22885409
  31. 31. Кармона-Рибейро AM, де Мело Карраско LD. Катионные противомикробные полимеры и их сборки. Int J Mol Sci. 2013; 14: 9906–46. pmid: 23665898
  32. 32. Фирдесса Р., Эльшлегер Т.А., Молл Х. Идентификация множественных клеточных путей поглощения наночастиц полистирола и факторов, влияющих на поглощение: актуальность для систем доставки лекарств. Eur J Cell Biol.2014; 93: 323–37. pmid: 25224362
  33. 33. Понте-Сукре А., Гульдер Т., Вегехаупт А., Альберт С., Риканович С., Шефляйн Л. и др. Взаимосвязь структура-активность и исследования молекулярного механизма лейшманицидных N, C-связанных солей арилизохинолиния. J Med Chem. 2009. 52: 626–36. pmid: 115
  34. 34. Брингманн Г., Томале К., Бишоф С., Шнайдер С., Шультейс М., Шварц Т. и др. Новый анализ на основные амастиготы Leishmania в 96-луночном формате для быстрого скрининга лекарств и его использование для открытия и оценки нового класса лейшманицидных солей хинолиния.Антимикробные агенты Chemother. 2013; 57: 3003–11. pmid: 23587955
  35. 35. Lang T, Goyard S, Lebastard M, Milon G. Биолюминесцентная лейшмания, экспрессирующая люциферазу, для быстрого и высокопроизводительного скрининга лекарств, действующих на макрофаги, несущие амастиготы, и для количественного мониторинга в реальном времени признаков паразитизма у живых мышей. Cell Microbiol. 2005; 7: 383–92. pmid: 15679841
  36. 36. Chekeni FB, Elliott MR, Sandilos JK, Walk SF, Kinchen JM, Lazarowski ER, et al.Каналы паннексина 1 обеспечивают высвобождение сигнала «найди меня» и проницаемость мембран во время апоптоза. Природа. 2010; 467: 863–7. pmid: 20944749
  37. 37. О’Мэлли LP, Хассан К.З., Бриттан Х., Джонсон Н., Коллинз А.Н. Характеристика биоцида полигексаметиленбигуанида с помощью матричной лазерной десорбционной ионизации времяпролетной масс-спектрометрии. J Appl Polym Sci. 2006. 102: 4928–4936.
  38. 38. Икеда Т., Тазуке С., Ватанабе М. Взаимодействие биологически активных молекул с фосфолипидными мембранами.I. Изучение флуоресцентной деполяризации влияния полимерного биоцида, содержащего бигуанидные группы в основной цепи. Biochim Biophys Acta. 1983; 735: 380–6. pmid: 6639946
  39. 39. Rusciano G, Capriglione P, Pesce G, Del Prete S, Cennamo G, Di Cave D и др. Рамановский микроскопический анализ в лечении акантамебного кератита. PLoS One. 2013; 8: e72127. pmid: 23977228
  40. 40. Wessels S, Ingmer H. Механизмы действия трех дезинфицирующих активных веществ: обзор.Regul Toxicol Pharmacol. 2013; 67: 456–67. pmid: 24080225
  41. 41. Аллен М.Дж., Морби А.П., Уайт Г.Ф. Кооперативность в связывании катионного биоцида полигексаметиленбигуанида с нуклеиновыми кислотами. Biochem Biophys Res Commun. 2004; 318: 397–404. pmid: 15120614
  42. 42. Кастильо Б., Бромберг Л., Лопес Х, Бадильо В., Гонсалес Фелисиано Х.А., Гонсалес К.И. и др. Внутриклеточная доставка миРНК поликатионными суперпарамагнитными наночастицами. J Drug Deliv. 2012; 2012: 218940.pmid: 22970377
  43. 43. Ramírez-Pineda JR, Fröhlich A, Berberich C, Moll H. Дендритные клетки (DC), активированные CpG ДНК ex vivo, являются мощными индукторами устойчивости хозяина к внутриклеточному патогену, который не зависит от IL-12, полученного из иммунизирующих DC. J Immunol. 2004; 172: 6281–9. pmid: 15128817
  44. 44. Ново Л., Риццо Л. Я., Голомбек С. К., Даквар Г. Р., Лу Б., Ремаут К. и др. Декатионизированные полиплексы как стабильные и безопасные системы-носители для улучшенного биораспределения в системной генной терапии.J Control Release. 2014; 195: 162–75. pmid: 25204289
  45. 45. Каен К. Полигексанид: безопасный и высокоэффективный биоцид. Skin Pharmacol Physiol. 2010; 23 Дополнение: 7–16. pmid: 20829657
  46. 46. Walls G, Noonan L, Wilson E, Holland D, Briggs S. Успешное использование местного полигексаметилен бигуанида в качестве дополнения к лечению грибкового остеомиелита. Может ли J заразить Dis Med Microbiol. 2013; 24: 109–12. pmid: 24421812
  47. 47. Мюллер Г., Кобургер Т., Крамер А.Взаимодействие гидрохлорида полигексаметиленбигуанида (PHMB) с фосфатидилхолином, содержащим эмульсию в / в, и последствия для микробицидной эффективности и цитотоксичности. Chem Biol Interact. 2013; 201: 58–64. pmid: 23313712
  48. 48. Hirsch T, Jacobsen F, Rittig A, Goertz O, Niederbichler A, Steinau HU и др. [Сравнительное исследование in vitro клеточной токсичности клинически используемых антисептиков]. Hautarzt. 2009; 60: 984–91. pmid: 19812986
  49. 49. Das S, Rani M, Rabidas V, Pandey K, Sahoo GC, Das P.TLR9 и MyD88 имеют решающее значение для созревания и активации дендритных клеток с помощью комбинированной терапии паромомицином и милтефозином при висцеральном лейшманиозе. Br J Pharmacol. 2014; 171: 1260–74. pmid: 24670148
  50. 50. Гош М., Рой К., Рой С. Иммуномодулирующие эффекты антилейшманиозных препаратов. J Antimicrob Chemother. 2013; 68: 2834–8. pmid: 23833177
  51. 51. Инь Х, Канасты Р.Л., Эльтоухи А.А., Вегас А.Дж., Доркин Дж.Р., Андерсон Д.Г. Невирусные векторы для генной терапии.Nat Rev Genet. 2014; 15: 541–55. pmid: 25022906
  52. 52. Джебран А.Ф., Шлейхер У., Штайнер Р., Венткер П., Махфуз Ф., Шталь Х.С. и др. Быстрое заживление кожного лейшманиоза с помощью высокочастотной электрокаутеризации и обработки ран гидрогелем с использованием или без DAC N-055: рандомизированное контролируемое исследование фазы IIa в Кабуле. PLoS Negl Trop Dis. 2014; 8: e2694. pmid: 24551257

енотовидных патогенов, важных для человека — вирусы и бактерии

Северные еноты ( Procyon lotor , рис. 1) могут переносить множество болезней, которые представляют серьезную опасность для здоровья как людей, так и домашних животных.Некоторые из этих заболеваний протекают бессимптомно, не проявляют признаков инфекции и часто не поражают енотов, но все же могут передаваться и быть смертельными для других животных, включая человека. Поскольку невозможно быть уверенным в том, что дикое животное болеет, безопаснее считать животное опасным и избегать его. Обратитесь в службу контроля за животными или к специалисту по реабилитации диких животных, если вы подозреваете, что животное болеет или ведет себя ненормально (контактные данные специалистов по реабилитации диких животных Флориды можно найти на веб-сайте Комиссии по охране рыб и дикой природы Флориды).Больные дикие животные могут вести себя прирученными и сбитыми с толку, но никогда не следует приближаться к ним, как к прирученным. Они по-прежнему дикие животные, которые, вероятно, будут рассматривать вас как угрозу и могут действовать агрессивно. Из-за успешной адаптации к городской среде еноты часто контактируют с людьми. Этот документ является частью серии, посвященной опасностям для здоровья, связанным с енотами, и конкретно описывает наиболее важные вирусы и бактерии, переносимые енотами. Информацию о других паразитах, переносимых енотами, а также более подробную информацию о круглых червях енотовидных Baylisascaris procyonis можно найти в других документах этой серии.Следующие вирусы и бактерии, как известно, встречаются у енотов и вызывают беспокойство у людей и / или домашних животных: бешенство, чума собак, чума / панлейкопения кошек, парвовирус собак, Salmonella , туляремия, септицемия Edwardsiella и лептоспироз (см. Таблица 1 для обобщения и профилактики).



Бешенство — это вирус рибонуклеиновой кислоты (РНК) из семейства Rhabdoviridae и одно из самых смертоносных известных заболеваний.Если не лечить на ранней стадии, бешенство почти на 100 процентов приводит к летальному исходу. Около десятка человек в зарегистрированной истории заразились бешенством и выжили без своевременного лечения бешенства и вакцинации до или после контакта. Напротив, во всем мире от бешенства ежегодно умирает более 59 000 человек. Ежегодно в Соединенных Штатах происходит от 1 до 2 смертельных случаев; однако тысячи людей обращаются за постконтактным лечением. Большинство смертей от бешенства происходит в Африке и Азии, где вакцинация и лечение не так доступны.Множество организаций, включая Центры по контролю и профилактике заболеваний (CDC) и Всемирную организацию здравоохранения (ВОЗ), стремятся к 2030 году положить конец всем смертям от бешенства среди людей с помощью вакцинации и обучения.

Бешенство передается со слюной инфицированных млекопитающих, включая летучих мышей, енотов, скунсов, лисиц, собак, других собак, кошек и домашний скот. Теоретически бешенством может заразиться любое млекопитающее, хотя о перечисленных выше случаях сообщается больше всего. Во всем мире 99 процентов случаев заболевания людей вызваны непривитыми собаками.Однако в Соединенных Штатах обязательная вакцинация собак значительно снизила количество случаев заболевания собак и, следовательно, количество случаев заражения людей бешенством. Большая часть воздействия на человека (92,7 процента в 2018 году) в Соединенных Штатах происходит от видов диких животных (летучие мыши 33 процента, еноты 30,3 процента, скунсы 20,3 процента и лисы 7,2 процента), а большинство человеческих смертей от бешенства происходит от летучих мышей. В этих случаях жертва не знала, что летучие мыши подвержены риску заражения бешенством, или не осознавала, что их укусили.Текущие данные CDC о бешенстве в США можно найти на их веб-сайте. Данные показывают, что, хотя летучие мыши, больные бешенством, встречаются во всех штатах, кроме Гавайев, варианты бешенства, связанные с плотоядными животными среднего размера, географически отличаются в Соединенных Штатах (рис. 2). В частности, еноты служат резервуаром бешенства на юге и востоке США. Это не означает, что еноты — единственный вид, который может заразиться бешенством в этом районе; возможна межвидовая передача вариантов вируса бешенства (например, заражение собак вариантом бешенства енота).К счастью, вакцинация домашних животных и образование значительно снизили количество случаев бешенства среди людей и домашних животных во многих регионах мира.

Бешенство может вызывать агрессивное поведение и повышенное слюноотделение; однако это далеко не единственные симптомы. Бешеное животное также может вести себя прирученно, становиться активным в необычные часы или проявлять неврологические отклонения. Еноты иногда будут добывать пищу в течение дня, если будет тихо, поэтому дневное наблюдение за енотом само по себе не является поводом для беспокойства.Однако, если енот не боится людей или демонстрирует неврологические отклонения, он может быть бешеным. В любом случае, енотов, как и всех диких животных, следует избегать.

Бешенство наблюдается в каждом округе штата Флорида (рис. 3, таблица 2). Департамент здравоохранения Флориды ежегодно публикует отчеты о зарегистрированных случаях, которые можно найти на веб-сайте Департамента здравоохранения Флориды. В 2017 году среди диких животных было зарегистрировано 78 случаев бешенства, 36 из которых были от енотов.

Рисунок 3. Случаи бешенства, передаваемого енотами, во Флориде по округам (1997–2018 гг.). Округ Тейлор — единственный округ Флориды, в котором с 1997 года не зарегистрировано ни одного случая бешенства, передаваемого енотами. В округе Мэрион зарегистрировано наибольшее количество случаев заболевания — 171.
Предэкспозиционная вакцинация

Предэкспозиционная вакцинация против бешенства доступна для людей, но даже если предконтактная вакцинация проводится, по-прежнему необходимо немедленно обратиться за лечением после контакта с потенциально бешеным животным .Из-за высокой стоимости (предэкспозиционная вакцинация в США может стоить более 1000 долларов) профилактическое лечение рекомендуется только людям, которые с большей вероятностью контактируют с бешеными животными, например ветеринарам, исследователям, смотрителям зоопарка, диким животным. специалисты по реабилитации, инспекторы по контролю за животными или люди, путешествующие в регионы, где широко распространено бешенство. Вакцинацию можно получить в кабинетах врачей, туристических клиниках и больницах. Предэкспозиционная вакцинация состоит из трех прививок в 1, 7, 21 или 28 день.Предэкспозиционная вакцинация устраняет необходимость в дорогостоящем лечении иммуноглобулином, но все же необходимо модифицированное постконтактное лечение для защиты пациента от заражения бешенством. Если человеку не сделана предконтактная вакцинация, а это подавляющее большинство людей, то требуется другой курс лечения (см. Следующий раздел).

Также доступны прививки для животных. Вакцинация собак от бешенства обязательна по закону во всех 50 штатах, а кошек и хорьков — в большинстве штатов, включая Флориду.Стоимость намного дешевле, примерно от 20 до 30 долларов за выстрел в год. Дикие животные также могут быть вакцинированы, и ежегодно Служба охраны дикой природы Службы инспекции здоровья животных и растений Министерства сельского хозяйства США (USDA) прилагает большие усилия для распространения пероральной вакцины против бешенства с целью сокращения распространения бешенства енотов. на запад. Более подробную информацию, включая карту, можно найти на веб-сайте USDA. Бешенство енотов — преобладающий тип бешенства во Флориде.Частоту распространения бешенства, передаваемого енотами во Флориде, с течением времени можно найти на Рисунке 4.

Рисунок 4. Распространенность бешенства, передаваемого енотами, во Флориде по годам (1997–2018 гг.).
Постэкспозиционная обработка

Без документации о текущей вакцинации против бешенства рассматривать укус любого млекопитающего как возможный случай заражения бешенством. Не подвергайте себя опасности, пытаясь собрать потенциально бешеного енота. Вместо этого сообщите в службу контроля животных. Кошку или собаку можно наблюдать в течение десяти дней для выявления клинических признаков.Недостаточно подтверждающих данных относительно сроков распространения вируса, чтобы доказать, что одного наблюдения достаточно для других животных. К сожалению, единственный быстрый и надежный тест включает рассечение мозга, поэтому требуется эвтаназия животного.

Если есть вероятность заражения бешенством, крайне важно начать лечение сразу после укуса или царапины. Поскольку вирус находится в слюне, бешеному животному не нужно укусить, чтобы передать бешенство: оно может передать болезнь, облизывая поврежденную кожу.Немедленно промойте раны. Один из наиболее эффективных способов снизить вероятность заражения — тщательно промыть рану водой с мылом. Постэкспозиционную обработку следует начинать сразу после контакта. Рекомендации Всемирной организации здравоохранения по постэкспозиционной обработке можно найти на их веб-сайте. Постэкспозиционное лечение доступно в отделениях неотложной помощи и окружных отделениях здравоохранения. CDC также рекомендует проводить вакцинацию против столбняка, которую необходимо делать каждые 10 лет.

Постэкспозиционная терапия состоит из четырех-пяти уколов в очаг инфекции или в руку. Уколы делают в дни 0, 3, 7 и 14, а для пациентов с ослабленной иммунной системой иногда — на 28 день. Человеческий антирабический иммуноглобулин, состоящий из антител против бешенства, также вводят в день 0. Всем, кто был вакцинирован ранее. в дни 0 и 3 пациенту делаются ревакцинации, но иммуноглобулин отсутствует. Помните, что независимо от стоимости или тяжелых испытаний, альтернативой является потенциально неизлечимая смертельная болезнь.Постконтактная вакцинация оказалась весьма успешной в снижении числа случаев смерти людей от бешенства в Соединенных Штатах с более чем 100 случаев в год до 1–2 случаев в год. Эти случаи обычно ограничиваются людьми, которые не знали, что они подверглись воздействию бешеного животного, не знали о риске контакта с дикими животными или были укушены собакой в ​​чужой стране и не обращались за лечением. Если вы подозреваете, что могли подвергнуться контакту с бешеным животным, обратитесь в отдел здравоохранения вашего округа или в Центры по контролю за заболеваниями; они могут помочь вам определить, подвергались ли вы воздействию.

Дополнительную информацию о бешенстве можно найти в «Фактах о болезнях диких животных: бешенство».

Чума собак

Вирус чумы собак , также известный как Собачий морбилливирус , представляет собой высококонтагиозный РНК-вирус семейства Paramyxoviridae. Собачья чума является основной естественной причиной смерти енотов сразу после человеческих смертей. Вирус чумы собак не может заразить людей, но он может заразить и убить многих хищников, включая псовых, медведей, куньих (ласки, хорьки, скунсы и т. Д.).), крупные представители семейства кошачьих (не включая домашних домашних кошек), проциониды (еноты, кинкажу, рингтейлы и т. д.) и тюлени. В то время как каждая группа упомянутых млекопитающих находится в зоне риска, инфекция у собак, по-видимому, наиболее распространена и является серьезной проблемой для домашних собак. Вакцинация для собак стоит недорого, и ее можно легко получить в кабинетах ветеринаров или передвижных клиниках. Вирусы, вызывающие чумку собак и кошек (см. Следующий раздел), не связаны между собой, и клинические признаки различаются. Оба вируса могут заразить енотов и являются очень серьезными заболеваниями.

Симптомы чумы собак могут варьироваться от появления инфекции верхних дыхательных путей (URI) до неврологических признаков, напоминающих бешенство. Он начинается с выделений из носа, лихорадки, конъюнктивита (воспаления и покраснения глаз), вялости, диареи и отсутствия аппетита. По мере развития болезни могут стать очевидными неврологические проблемы. Собаки стали жертвами инфекции с признаками ИВДП или вообще без признаков. Наклон головы, подергивание мышц, дезориентация, судороги и ухудшение моторики можно увидеть на более поздних стадиях.На данный момент заражение вирусом чумы трудно отличить от бешенства.

Вирус передается через прямой или косвенный контакт с инфицированной кровью, слюной или мочой. Хотя специального лечения не существует, симптомы можно облегчить, а животное может получить поддержку и дать ему лучшую возможность выздороветь, используя его собственную иммунную систему. Выжившие животные могут проявлять пожизненные симптомы, начиная от затвердевания подушечек лап и заканчивая глазными или неврологическими симптомами.

Чума кошачья / панлейкопения

Чума кошек , также известная как панлейкопения кошек (FP), представляет собой заболевание, вызываемое высококонтагиозным парвовирусом кошек.Это не связано с чумой собак, но также смертельно опасно для енотов. Парвовирус кошек не может заразить людей, но может заразить и убить кошек. Отбеливатель можно использовать как дезинфицирующее средство; вирус устойчив ко многим другим химическим веществам. Вакцинация стоит дешево и легко доступна в ветеринарных кабинетах и ​​мобильных клиниках. Он наиболее опасен для котят и кошек с ослабленной иммунной системой. В остальном здоровые взрослые кошки имеют неплохие шансы на выживание.

Симптомы включают жар, депрессию, анорексию, обезвоживание, рвоту, диарею, боль в животе, а иногда и отсутствие симптомов.Лечение является поддерживающим и состоит из введения жидкостей, переливания крови или плазмы и антибиотиков при вторичных инфекциях.

Парвовирус кошек распространяется через носовые выделения, кровь, фекалии, мочу или блох, которых кормило инфицированное животное. Он также может передаваться через плохую гигиену рук, посуду для кормления и другие материалы. Парвовирус кошек быстро атакует, деля клетки крови в костном мозге, кишечном эпителии и лимфатических узлах. Если кошка выживает, долгосрочные последствия обычно отсутствуют.

Парвовирус собак

Собачий Parvovirus , или parvo, — это очень заразный вирус семейства Parvoviridae, вызывающий серьезные заболевания у собак. Еноты могут переносить этот патоген бессимптомно, но он может убить невакцинированных собак. Вакцины против парвовируса недороги, их можно приобрести у ветеринаров и передвижных клиник.

Этот вирус поражает желудочно-кишечный тракт собаки. Парвовирусы обладают высокой устойчивостью к жаре, холоду и сушке и могут выживать в окружающей среде в течение длительных периодов времени.Отбеливатель можно использовать как дезинфицирующее средство; вирус устойчив ко многим другим химическим веществам. Он передается при прямом контакте с инфицированным животным, зараженными поверхностями или фекалиями. Признаки у собак включают потерю аппетита, боль в животе и вздутие живота, лихорадку, низкую температуру тела, диарею, рвоту и вялость. Большинство смертей наступает через 48-72 часа после появления симптомов.

Лечение является поддерживающим и включает нутритивную поддержку, борьбу с обезвоживанием, рвотой и диареей, а также лечение вторичных инфекций.Даже при поддерживающем лечении собака может погибнуть от инфекции. Особенно это актуально для щенков.



Salmonella — частая причина пищевых отравлений. Симптомы включают рвоту, жар и диарею. Эти симптомы обычно проходят через 3-8 дней без лечения. Однако иногда в тяжелых случаях требуются антибиотики или госпитализация. Подробная информация о Salmonella доступна в серии документов EDIS. Инфекция Salmonella чаще всего передается через зараженную пищу, но также может передаваться от инфицированных млекопитающих, птиц и рептилий в результате плохой санитарии, обычно в результате фекально-оральной передачи. По оценкам CDC, Salmonella заражает более миллиона человек в Соединенных Штатах каждый год, вызывая около 20 000 госпитализаций и 400 смертей. Salmonella может также инфицировать домашних млекопитающих и птиц и переноситься без симптомов рептилиями и земноводными.

Францизелла туларенская

Francisella tularensis вызывает туляремию, также известную как кроличья лихорадка, и может передаваться клещами и контактировать с инфицированными тканями млекопитающих. Туляремию сложно диагностировать у людей, и ее можно принять за другие заболевания. Большинство людей выздоравливают, но на это может потребоваться несколько недель лечения антибиотиками. Туляремия обычно не наблюдается у кошек и собак, но когда она заражает их, она может вызвать отказ системы органов, если ее не лечить на ранней стадии и агрессивно.Чтобы диагностировать туляремию, обычно необходимо сначала исключить несколько других заболеваний. Вакцина в настоящее время находится на рассмотрении. Было показано, что еноты сами переносят туляремию и переносят клещей, но неясно, как туляремия влияет на енотов. У людей воздействие может происходить через питье зараженной воды, укусы насекомых, переносящих болезнь, обращение с тушами животных, употребление в пищу недоваренной дичи или вдыхание высушенных инфекционных тканей животных. Еноты могут быть полезны как индикатор наличия туляремии в окружающей среде.

Эдвардсиелла Тарда

Edwardsiella tarda вызывает септицемию Edwardsiella, редкую, но потенциально смертельную инфекцию для людей и диких животных. Однако, E. tarda был обнаружен у здоровых животных, включая енотов. E. tarda был обнаружен в кишечнике многих рыб, рептилий, млекопитающих и птиц и передается через инфицированные фекалии животных. Воздействие загрязненной воды и рыбы являются важными факторами передачи.Фактически, большинство зарегистрированных случаев заболевания животных было связано с видами, тесно связанными с водой. Септицемия Edwardsiella часто вызывает гастроэнтерит. Доступно противомикробное лечение, однако недавний обзор литературы показал, что уровень смертности среди людей даже при лечении составляет 44 процента. Септицемия, вызванная Edwardsiella, остается редкостью, и факторы риска недостаточно изучены.


Leptospira Бактерии вызывают лептоспироз, который при отсутствии лечения может привести к поражению почек, печеночной недостаточности, менингиту, респираторной недостаточности и смерти.Практически все млекопитающие могут переносить лептоспироз и могут проявлять или не проявлять клинических признаков. Считается, что грызуны являются основным переносчиком. Он передается через загрязненную мочу и воду. Инфекция чаще всего встречается в теплых и влажных местах, но может возникать и в других местах. Лептоспироз наблюдается у собак, но редко встречается у людей в развитых странах. Сообщения о лептоспирозе, когда-то считавшемся заболеванием сельских районов, в городских районах растут, либо из-за увеличения распространенности этого заболевания, либо из-за более частого выявления.

Источники и дополнительная информация

Форрестер Д. Дж. 1992. Паразиты и болезни диких млекопитающих во Флориде . Издательство Университета Флориды, Гейнсвилл. 123–150. http://ufdc.ufl.edu/AA00025659/00001

Керн, У. Х. 2018. Северный енот . WEC-34. Гейнсвилл: Институт пищевых и сельскохозяйственных наук Университета Флориды. https://edis.ifas.ufl.edu/uw033


Клиника Майо. нет данных «Бешенство.»По состоянию на 14 мая 2020 г. https://www.mayoclinic.org/diseases-conditions/rabies/symptoms-causes/syc-20351821

Всемирная организация здравоохранения. 2020. «Бешенство». https://www.who.int/en/news-room/fact-sheets/detail/rabies

Чума собак

Криви, К. Э. 2018. «Обзор собачьей чумы». Ветеринарное руководство Merck, Merck & Co., Inc. https://www.merckvetmanual.com/generalized-conditions/canine-distemper/overview-of-canine-distemper

Кошачья чума

Сквайрс, Р.A. 2013. «Обзор панлейкопении кошек». Ветеринарное руководство Merck, Merck & Co., Inc. https://www.merckvetmanual.com/generalized-conditions/feline-panleukopenia/overview-of-feline-panleukopenia

Парвовирус собак

Американская ветеринарная медицинская ассоциация. 2013. «Парвовирус собак». https://www.avma.org/resources/pet-owners/petcare/canine-parvovirus-type-2c-faq

де Карденас, C. 2008. «Парво в собаках». Pet MD. https://www.petmd.com/dog/conditions/infectious-parasitic/c_dg_canine_parvovirus_infection


EDIS.нет данных Сальмонелла . По состоянию на 14 мая 2020 г. https://edis.ifas.ufl.edu/topic_salmonella


Уильямс, К. и Р. Даунинг. 2019. «Туляремия у собак». Больницы для животных VCA. https://vcahospitals.com/know-your-pet/tularemia-in-dogs

Edwardsiella tarda

Хираи Ю., С. Асахата-Таго, Ю. Айнода, Т. Фудзита и К. Кикучи. 2015. » Edwardsiella tarda Bacteremia. Редкая, но смертельная инфекция, передаваемая через воду и продукты питания: обзор литературы и клинических случаев из единого центра.» Канадский журнал инфекционных заболеваний и медицинской микробиологии 26: 313–318. Https://doi.org/10.1155/2015/702615

Уайт, Ф. Х., Дж. Дж. Уотсон, Г. Л. Хофф и У. Дж. Биглер. 1975. « Edwardsiella tarda Инфекции в енотах Флориды, Procyon lotor. » Архивы гигиены окружающей среды: Международный журнал 30: 601–603. https://doi.org/10.1080/00039896.1975.10666788


Американская ветеринарная медицинская ассоциация.нет данных «Лептоспироз.» По состоянию на 14 мая 2020 г. https://www.avma.org/public/PetCare/Pages/Leptospirosis.aspx

Центры по контролю и профилактике заболеваний. 2019. «Лептоспироз». https://www.cdc.gov/leptospirosis/index.html

Трэкслер Р. М., Л. С. Каллинан, Р. К. Холман, К. Штайнер и М. А. Герра. 2014. «Госпитализации, связанные с лептоспирозом, США, 1998–2009». Новые инфекционные заболевания 20: 1273–1279. https://dx.doi.org/10.3201/eid2008.130450


Таблица 1.

Сводка по вирусам и бактериям, передающимся енотами.



Заразить людей или домашних животных?




Слюна в укусах и царапинах

Люди и домашние животные млекопитающих


Смертельно при отсутствии лечения

Чума собак

Прямой или косвенный контакт с кровью, слюной или мочой

Хорьки и собаки


Часто со смертельным исходом; неврологические повреждения иногда у выживших

Чума кошачья

Кровь, кал, моча, блохи



Смертельно для котят, иногда со смертельным исходом для взрослых

Парвовирус собак

Прямой контакт, загрязненные поверхности



Лечение может предотвратить летальный исход



Фекально-оральная передача от зараженных пищевых продуктов или животных

Домашние животные людей, млекопитающих, птиц и рептилий


Обычно проходит без лечения, но могут потребоваться антибиотики; тяжелые случаи могут привести к летальному исходу

Francisella tularensis

Клещи, инфицированные ткани животных

Люди и домашние животные

Репеллент и удаление клещей, избегайте тканей животных

Антибиотики; успешен у людей, менее успешен у домашних животных

Edwardsiella tarda

Загрязненная вода и рыба

Редко для человека, может инфицировать домашних млекопитающих, земноводных и рептилий

Избегать зараженной воды и рыбы

Поддается лечению, но может быть смертельным


Загрязненная моча и вода

Чаще встречается у собак, встречается у людей и кошек

Санитария; избегать загрязненной воды

Может быть смертельным, не подавать признаков

Таблица 2.

Зарегистрированные случаи бешенства у енотов во Флориде в 1997–2018 гг. По округам (данные Министерства здравоохранения Флориды).



















































































































Индийская река




























Флорида Всего


Фактов о желтой лихорадке

1.Название и характер возбудителя

Желтая лихорадка (ЖЛ) — это инфекция приматов, переносимая африканскими комарами. Это вызвано вирусом из рода Flavivirus семейства Flaviviridae. В естественной среде обитания он передается между обезьянами через лесных приматофильных комаров Aedes . Вирус и его переносчик ( Ae. Aegypti ) были завезены в Америку, где он также является энзоотическим в лесной среде обитания, благодаря работорговле.

Сильватическое заражение людей происходит, когда они входят в лес для охоты, сбора пищи, заготовки древесины и так далее.Зараженные лесом люди могут инициировать передачу от человека к человеку, если в городах и деревнях присутствуют подходящие перидоместные переносчики. В городской среде Ae. (Stegomyia) aegypti (Linn.), Лесной вид, который адаптировался в домашней среде человека, является высокоэффективным переносчиком вируса желтой лихорадки (YFV). Этот комар также является основным переносчиком вирусов денге и чикунгунья в городах.

Желтая лихорадка распространена в Западной, Центральной и Восточной Африке и в Южной Америке, от Панамы до северной части Аргентины.В Азии он никогда не обнаруживался. В сельских районах Африки были зарегистрированы катастрофические эпидемии, унесшие жизни десятков тысяч человек.

Переносчик Aedes aegypti когда-то был эндемиком в Европе и стал причиной крупных эпидемий YF и денге. Причина его исчезновения после Второй мировой войны так и не была объяснена. Он все еще присутствует в Соединенных Штатах и ​​был зарегистрирован в 21 штате. Вполне возможно, что этот вектор может восстановиться и широко распространиться в Европе, как это произошло в последние годы с другим предполагаемым вектором, Ae.albopictus .

2. Клинические особенности

Симптомы появляются внезапно, обычно через 3-5 дней после заражения. Заболевание может вызывать широкий спектр симптомов, от легких до смертельных. В клинических случаях наблюдается внезапное начало лихорадки с сильной головной болью, артралгиями и мышечными болями. Желтуха может появиться на третьи сутки и указывает на плохой прогноз. Повышение уровня трансаминаз также является прогностическим. В тяжелых случаях может наблюдаться спонтанное кровотечение (рвота из кофейной гущи), почечная недостаточность, делирий, кома и смерть.Смертность от этих клинических случаев может достигать 80%, что сопоставимо с Эболой, Марбургом и другими геморрагическими вирусными инфекциями. Период выздоровления длительный, часто с серьезными последствиями.

3. Трансмиссия

3.1 Резервуар

Вирус циркулирует между обезьянами в лесу и между людьми в деревнях и городах. Основные лесные переносчики размножаются в дуплах деревьев и подобных небольших скоплениях воды. Инфекция у африканских обезьян протекает бессимптомно или в легкой форме; Об эпизоотиях сигнализируют, когда люди заражаются этим заболеванием.Напротив, вирус смертелен для приматов западного полушария; эпизоотии очевидны, «когда джунгли замолкают» из-за высокой смертности обезьян-ревунов.

3.2 Режим передачи

Укусы инфицированных комаров — единственный путь передачи.

Комары заражаются вирусом, когда питаются вирусом-хозяином, после чего (у восприимчивых видов) вирус поражает многие ткани, включая слюнные железы. Хотя для того, чтобы заразиться, может потребоваться несколько недель (и много еды с кровью), комары инфицированы на всю жизнь.

Новые инфекции у людей могут возникать, когда слюна, содержащая вирус, вводится неиммунному хозяину во время последующего приема пищи кровью. «Внешний инкубационный период», время, необходимое для того, чтобы комар стал заразным, составляет около десяти дней, в зависимости от температуры. Имеются также данные о вертикальной передаче (передача напрямую от взрослых самок комаров через яйца взрослым особям следующего поколения).

Виремия достигает высоких титров за день до появления симптомов и, как правило, достаточно высока, чтобы заразить комаров в течение следующих четырех дней.Иммунитет, наверное, пожизненный.

3.3 Группы риска

Все непривитые люди подвержены риску в зонах активной передачи. В последние годы ряд непривитых туристов из Европы и Северной Америки умерли от болезни после посещения энзоотических районов.

Aedes aegypti распространен повсеместно в тропиках, поэтому во многих тропических городах существует реальная и настоящая опасность крупной эпидемии.

4. Профилактические мероприятия

Безопасная, эффективная и недорогая аттенуированная вакцина против желтой лихорадки, известная как YF 17D, используется более полувека.Вакцина очень эффективна, но плановая вакцинация проводится очень немногими странами.

Свидетельство о вакцинации против YF — единственное свидетельство о вакцинации, которое требуется при международных поездках. Свидетельство о вакцинации против желтой лихорадки действительно в течение всей жизни вакцинированного человека, начиная с 10 дней после даты вакцинации. Перед вакцинацией следует проводить анализ индивидуального риска и пользы, особенно у пациентов с аутоиммунными заболеваниями, иммунодефицитом или другими сопутствующими сопутствующими заболеваниями, а также среди пожилых людей с учетом пункта назначения и продолжительности поездки, а также вероятности заражения. комары.

В начале 20 века городские YF были изгнаны из многих стран в результате энергичных кампаний по уничтожению Ae. aegypti мест размножения. После Второй мировой войны целенаправленное нанесение ДДТ на зараженные контейнеры и их окрестности имело выдающийся успех. По данным Панамериканской организации здравоохранения, этот вид был уничтожен в 22 странах Америки. В настоящее время заменителей ДДТ нет. Многие органы здравоохранения прибегают к инсектицидным аэрозолям, которые доставляются с ручных машин, дорожных транспортных средств или самолетов.Методика дорогая и малоэффективная. Более того, даже если бы был достигнут высокий уровень смертности, воздействие на взрослое население, вероятно, было бы слишком коротким, чтобы оказать эффективное воздействие на передачу. Всемирная организация здравоохранения в течение нескольких лет рекомендовала «сокращение источников на уровне сообществ», но нет никаких доказательств того, что это было успешным где-либо в мире.

Профилактика также основана на защите от укусов комаров. Комары Aedes в течение дня кусают как в помещении, так и на улице.Поэтому меры индивидуальной защиты следует применять в течение всего дня, особенно в часы наибольшей активности комаров (с утра, после полудня до сумерек). Меры индивидуальной защиты от укусов комаров включают использование противомоскитных сеток (предпочтительно сеток, обработанных инсектицидами), сон или отдых в помещениях с защитными экранами или кондиционерами, ношение одежды, закрывающей большую часть тела, и использование репеллентов от комаров в в соответствии с инструкциями, указанными на этикетке продукта.

5. Диагностика

Вирус может быть обнаружен в образцах крови с помощью ОТ-ПЦР, захвата антигена и / или выделения вируса. Серологический диагноз может быть поставлен путем обнаружения специфических антител IgM через неделю после заражения. Воздействие вируса YF обеспечивает пожизненный иммунитет.

6. Ведение и лечение

Поддерживающая терапия — единственный вариант, хотя использование противовирусных препаратов является активной областью исследований. Важно строго избегать приема аспирина и других антикоагулянтов.

7. Ключевые области неопределенности

Несмотря на обилие информации об экологии, эпидемиологии и патологии болезни, высокая вероятность крупных городских вспышек среди невакцинированного населения остается в районах, где присутствует переносчик Aedes aegypti .

Неблагоприятные (висцеротропные или нейротропные) явления после иммунизации после вакцинации против YF были зарегистрированы в основном в старших возрастных группах и у лиц с ослабленным иммунитетом.Эти случаи потребуют дальнейшего расследования, чтобы собрать и проверить доказательства связи между вакциной и клиническим заболеванием, чтобы поддержать принятие решений относительно вакцинации против YF.

8. Список литературы

Кросби М. Американская чума: нерассказанная история желтой лихорадки, эпидемии, которая сформировала нашу историю. Беркли, Калифорния: Издательская группа Беркли; 2007.
Monath TP. Желтая лихорадка: Виктор, Виктория? Завоеватель, завоевание? Эпидемии и исследования за последние сорок лет и перспективы на будущее.Am J Trop Med Hyg 1991; 45 (1): 1-43.
Monath TP. Лечение желтой лихорадки. Antiviral Res 2008; 78 (1): 116-24.
Рейтер П. Изменение климата и болезни, передаваемые комарами. Environ Health Perspect 2001; 109 Дополнение 1: 141-61.
Reiter P, Nathan M. Руководство по оценке эффективности инсектицидных аэрозольных аэрозолей для борьбы с переносчиком денге, Aedes aegypti . Женева: Всемирная организация здравоохранения; 2001.


Добавить комментарий

Ваш адрес email не будет опубликован.