Вирус коксаки и экхо: B34.1 Коксаки-и ECHO-инфекция | Описание болезни, диагностика, лечение

Содержание

B34.1 Коксаки-и ECHO-инфекция | Описание болезни, диагностика, лечение

жалобы по диагнозу

  • Лихорадка (Повышенная температура)

    повышение температуры тела выше нормальных величин (36,0-36,9), причем утром на 0,3-0,5 С ниже, чем вечером, в полости рта и прямой кишке температура, как правило, на 0,5-1 С выше, чем в подмышечной впадине, но не превышает 37,5 С

  • Язвенные высыпания в полости рта
  • Высыпания в виде пузырьков

    пузырек (везикула) более 0,5 см в диаметре с полостью, наполненной жидким содержимым

  • Сыпь на ладонях
  • Сыпь на стопах
  • Боль в животе

симптомы по диагнозу

  • ГипертермияПовышение температуры тела выше 38,5*С
  • Боль в горле
  • ЭкзантемаВысыпания на коже: везикулы, папулы, волдыри, пятна и т.д.
  • Везикулёзные высыпания на стопах, ладонях, во рту.
  • МиалгияБоль в мышцах.
  • Кишечная диспепсияОсновные симптомы кишечной диспепсии являются изжога, отрыжка, тошнота и метеоризм, нарушения стула.
  • Вздутие кишечника

краткое описание диагноза

Коксаки-и ECHO-инфекция

Вирус Коксаки (ECHO инфекция) отностится к роду энтеровирусов. 
Коксаки – название города в США, где была зафиксирована эпидемия полиомиелитоподобного заболевания, вызванного неизвестным на то время вирусом. Идентифицированный в дальнейшем вирус получил название Коксаки. ЕСНО — это аббревиатура от слов Entero Cytopathic Humen Orphan.
Передается инфекция как воздушно-капельным, так и контактным путем. Возможно заражение через инфицированные продукты и воду. Распространению инфекции способствуют скученность и антисанитарные условия. Болеют чаще дети в возрасте 3–10 лет. В основном энтеровирусная инфекция протекает бессимптомно. Большая часть клинически заметных проявлений – простудоподобные заболевания, причем энтеровирусы считаются вторым по частоте возбудителем ОРВИ. Начало заболевания острое: ухудшается состояние, появляются слабость, вялость, головная боль, иногда рвота. Температура повышается, иногда до 39–40°.

Другое название заболевания «болезнь кистей, стоп и рта» – (hand, foot and mouth disease). Это название происходит от особенностей клинических проявлений: появления везикулёзных высыпаний в полости рта, на ладонях и стопах.

самопомощь при диагнозе

Самолечение не желательно.

режим лечения

средний срок выздоравления

ГБУЗ «Городская поликлиника»| Энтеровирусные болезни. Симптомы, профилактика и лечение |


Энтеровирусные болезни — острые инфекционные заболева­ния, вызываемые кишечными вирусами из группы Коксаки и ECHO. Клинические проявления многообразны, нередко связаны с поражением центральной нервной системы, мышц, миокарда и кожных покровов.

Этиология. Возбудители энтеровирусных болезней—неполиомиелитные вирусы. Кишечные вирусы относятся к пикорнавирусам (семейство Picornavindae, род Enterovirus). Существует 23 серотипа вируса Коксаки А, 6 серотиггов Коксаки В, 32 серотипа

виру­сов ECHO и еще 5 энтеровирусов человека (энтеровирусы 68-72 типов). Энтеровирус 70 является возбудителем острого геморраги­ческого конъюнктивита. Энтеровирус 72 соответствует вирусу ге­патита А (см. вирусные гепатиты). Общие свойства энтеровирусов: а) небольшие размеры (15-35 нм), б) содержат РНК, в) устойчивы к эфиру, 70% спирту, 5% лизолу, к замораживанию.

Эпидемиология.

Источником инфекции является только чело­век. Инфекция передается воздушно-капельным (от больных) и фекально-оральным (от вирусоносителей) путем. Заболевание рас­пространено повсеместно. В странах умеренного климата харак­терна сезонность с повышением заболеваемости в конце лета и в начале осени. Заболевают преимущественно дети и лица молодо­го возраста. Заболевания наблюдаются в виде спорадических слу­чаев, локальных вспышек (чаще в детских коллективах) и в виде крупных эпидемий, поражающих ряд стран.

Патогенез. Кишечные вирусы проникают в организм через сли­зистую оболочку верхних отделов респираторного и пищевари­тельного тракта. В ряде случаев на месте ворот инфекции возни­кают изменения в виде поражения слизистых оболочек (синдром острого респираторного заболевания, фарингиты, герпангина). После накопления вируса в месте первичного размножения возбудитель проникает в кровь (вирусемия) и разносится по всему организму. Энтеровирусы обладают тропизмом к нервной ткани, мышцам и эпителиальным клеткам, что проявляется и в клиничес­кой картине болезни, а также в морфологических изменениях тка­ней. Некоторое значение имеет лимфогенное распространение ви­русов. У беременных возможно внутриутробное поражение пло­да. Перенесенное энтеровирусное заболевание (или инаппарантная инфекция) оставляет после себя иммунитет к тому типу вируса, которым была обусловлена инфекция. Существуют перекрестные иммунологические реакции к некоторым энтеровирусам.

Симптомы и течение. Инкубационный период продолжается от 2 до 10 дней (чаще 3-4 дня). Энтеровирусные болезни характе­ризуются многообразием клинических проявлений. Некоторые из клинических форм (герпангина, эпидемическая миалгия, перикар­диты) связаны с определенной группой энтеровирусов. Заболева­ния начинаются остро. Ниже приводится краткая характеристика отдельных клинических форм. Нередко наблюдаются сочетанные признаки различных клинических форм.

Герпангина вызывается вирусами Коксаки А (серотипы 2,3,4, 6,7 и 10) и Коксаки В-3. Заболевание начинается остро, быстро повышается температура тела до 39-40°С, однако общее состоя­ние больных остается удовлетворительным. Лихорадка длится 2-5 дней. Боли в горле выражены умеренно или отсутствуют. Харак­терны изменения зева: на фоне умеренно гиперемированной сли­зистой оболочки зева появляются единичные (от 1 до 20) четко отграниченные элементы, которые иногда представлены в виде небольших папул (1-2 мм в диаметре), затем они превращаются в пузырьки (до 5 мм), наполненные прозрачной жидкостью. Пузырь­ки быстро лопаются, и на их месте возникают поверхностные изъязвления, покрытые сероватым налетом и окруженные узким венчиком гиперемированной слизистой оболочки. Отдельные яз­вочки могут сливаться, образуя более обширные дефекты (до 7 мм). Расположены они на передних дужках, реже на нёбе, язычке, нёбных миндалинах. К 4-7-му дню болезни наступает заживление дефекта слизистой оболочки без каких-либо следов. У 1/3 больных наблюдаются и другие проявления энтеровирусных заболеваний.

Эпидемическая миалгия (плевродиния, болезнь Борнхольма) вы­зывается вирусами Коксаки В (типы 1-5), Коксаки А-9 и возможно некоторыми вирусами ECHO (типы 1,6,9). Заболевание начинается внезапно. Появляется озноб, повышение температуры тела (до 39-40°С) и почти одновременно сильнейшие мышечные боли, которые локализуются в мышцах живота (часто в пупочной области) и в ниж­них отделах грудной клетки. Боль усиливается при движении, кашле. Приступы миалгаи продолжаются 5-10 мин и повторяются через 30-60 мин. Иногда они более длительны (от нескольких часов до 1-2 сут). Лихорадка чаще длится 2-3 дня. У половины больных отмечает­ся вторая волна лихорадки с новым приступом болей. У отдельных больных в это время развивается картина серозного менингита (на 5-7-й день болезни). Из других симптомов часто отмечают гиперемию слизистой оболочки зева, лимфаденопатию, иногда экзантему.

Серозный менингит — одна из распространенных форм энтеровирусных болезней, вызывается всеми группами энтеровирусов (Коксаки А (типы 2,4,7,9), Коксаки В (типы 1-5), ECHO (типы 4, 6,9,11,16, 30). Наблюдается как в виде спорадических случаев, так и в виде эпидемических вспышек. Начинается остро с повы­шения температуры тела (до 39—40°С) и симптомов общей инток­сикации. К концу 1 -го или на 2-й день болезни появляются четко выраженные менингеальные симптомы (сильная головная боль, ри­гидность затылочных мышц, симптомы Кернига, Брудзинского и др.). Иногда наблюдаются другие симптомы энтеровирусной ин­фекции (миалгия, экзантема, поражение миокарда, гиперемия сли­зистой оболочки зева). Спинномозговая жидкость вытекает под давлением, прозрачная, цитоз 200-300 в 1 мкл, нейтрофилов до 50%, содержание сахара и хлоридов нормальное. У некоторых больных отмечается вторая волна лихорадки.

Миелит (с параличами) может вызываться вирусами Коксаки А (типы 4,7,10,14) и В (типы 1-6), а также вирусами ECHO (типы 2,4,6,7,9,11,16). По клиническим симптомам и течению напо­минает паралитические формы полиомиелита. Протекает легче. Парезы.и параличи проходят относительно быстро с восстановле­нием двигательных функций. Иногда протекают тяжело. Описаны летальные исходы.

Энцефаломиокардит новорожденных вызывается вирусами Кок­саки В (типы 2-5). Характеризуется тяжелым течением и высокой летальностью (до 60-80%). Описаны небольшие вспышки. Основ­ные признаки: лихорадка, расстройство питания, повышенная сонливость, судороги, цианоз, желтуха, тахикардия, расширение границ сердца, коллапс, геморрагии, увеличение печени и селезенки, понос.

Энцефалит

вызывается вирусами Коксаки и ECHO. Тяжесть заболевания широко варьирует. В легких случаях проявляется лишь отдельными, не резко выраженными симптомами и изменениями ЭЭГ. В тяжелых случаях протекает с нарушением сознания, хореоподобными подергиваниями мышц, судорогами, нистагмом, пара­личом лицевого нерва.

Перикардиты и миокардиты вызываются вирусами Коксаки В (типы 2-5) и вирусами ECHO (типы 1,6,8,9,19). Появляются умеренная лихорадка, общая слабость, боли в области сердца, глу­хость тонов, шум трения перикарда, возможен выпот в полость пе­рикарда. Выявляются характерные для миокардита изменения ЭКГ. Течение благоприятное.

Инфекционная экзантема (бостонская экзантема, эпидемичес­кая экзантема, кореподобная и краснухоподобная экзантемы) чаще обусловлена вирусами ECHO (типы 4,5,9,12,16,18), реже виру­сами Коксаки (А-9, А-16, В-3). Заболевание начинается остро. По­вышается температура тела до 38-39°С, отмечаются симптомы интоксикации (слабость, головная боль, мышечные боли, боли в горле). Через 1-2 дня появляется сыпь, которая в выраженных слу­чаях захватывает туловище, конечности, лицо, стопы. По характе­ру экзантема чаще краснухе- или кореподобная, реже скарлатиноподобная или петехиальная. Через 3-4 дня она исчезает. Лихорад­ка длится 1 -7 дней. У отдельных больных наблюдаются и другие проявления болезни (серозный менингит, эпидемическая миалгия).

Своеобразный вариант энтеровирусной экзантемы—заболе­вание, протекающее с поражением кистей, стоп, полости рта (Hand-Fuss —• Mund Krankheit, или сокращенно HFMK). При этой форме на фоне умеренной интоксикации и небольшого повышения тем­пературы тела на пальцах кистей и стоп появляется экзантема в виде небольших везикул диаметром 1-3 мм, слегка выступающих над уровнем кожи и окруженных венчиком гиперемии. Одновременно на языке и слизистой оболочке щек обнаруживают единичные не­большие афтозные элементы. Заболевание вызывается вирусами Коксаки А (серотипы 5,10,16).

Малая болезнь (трехдневная лихорадка, летний грипп, неопре­деленная лихорадка, Коксаки- и ЕСНО-лихорадка) может быть вызвана всеми типами энтеровирусов. Характеризуется кратковремен­ностью и легкостью течения, а также отсутствием выраженных из­менений со стороны отдельных органов и систем. Проявляется в виде умеренной кратковременной лихорадки (1-3-дневная), сла­бости, разбитости, мышечных болей. Иногда отмечаются стертые признаки других клинических форм (нерезко выраженная эпиде­мическая миалгия, герпангина без типичных изменений в зеве, сла­бые менингеальные симптомы и пр.).

Острый катар верхних дыхательных путей вызывается мно­гими типами энтеровирусов. При инфекции, обусловленной виру­сом Коксаки А-21, эта форма является преобладающей. В отли­чие от малой болезни в таких случаях кратковременная лихорадка сочетается с выраженным воспалением слизистой оболочки верх­них дыхательных путей (ринофарингит, ларингит, у детей может возникнуть синдром крупа).

Энтеровирусиая диарея может наблюдаться не только у де­тей, но и у взрослых. Понос может сочетаться с другими проявле­ниями энтеровирусных болезней или быть основным признаком за­болевания. У некоторых больных симптомы энтероколита сочета­ются с выраженной картиной острого мезаденита, что нередко обусловливает диагностические трудности.

Эпидемический геморрагический конъюнктивит обусловлен энтеровирусом 70. Заболевание начинается остро. Обычно сначала поражается один глаз, через 1 -3 дня процесс захватывает и второй глаз. Отмечается светобоязнь, слезотечение, ощущение инородного тела. Общее состояние больного остается удовлетворительным. При осмотре наблюдается отек век, гиперемия и припухлость конъюнк­тив, кровоизлияния в конъюнктиву, чаще верхнего века, отделяемое скудное, слизисто-гнойное или серозное. Роговица поражается ред­ко. Нормализация наступает через 10-14 дней.

Диагноз и дифференциальный диагноз. При ряде клиничес­ких форм диагноз может быть установлен на основании характер­ной клинической симптоматики (герпангина, эпидемическая миал­гия, серозный менингит с экзантемой, эпидемический конъюнкти­вит), особенно во время эпидемических вспышек. Диагностика спорадических энтеровирусных заболеваний нередко вызывает трудности. Для лабораторного подтверждения диагноза использу­ют выделение вирусов (из слизи и смывов зева, спинномозговой жидкости, испражнений) и серологические исследования. Следует учи­тывать, что выделение вирусов из кала может наблюдаться и у здо­ровых вирусоносителей. Для серологических исследований берут парные сыворотки (первая до 4-5-го дня болезни, вторая—после 14-го дня болезни). Диагностическим считается нарастание титра антител в 4 раза и более. Используют реакцию нейтрализации с эта­лонными штаммами энтеровирусов (на тканевых культурах или мышатах-сосунках), РСК, РТГА, реакцию преципитации в геле.

Дифференциальный диагноз проводят в зависимости от клини­ческой формы (с серозными менингитами, инфекционными конъ­юнктивитами, ротавирусными диареями, полиомиелитом и др.). Особая осторожность необходима при диагностике эпидемической миалгии, которая бывает сходна с острыми хирургическими заболе­ваниями (острый аппендицит, кишечная непроходимость и др.).

Лечение. Этиотропного лечения нет. Имеются указания об эффек­тивности иммуноглобулина с высоким титром антител при лечении больных тяжелыми формами энтеровирусного энцефалита у лиц с дефицитом антител. Назначают общеукрепляющие и симптоматичес­кие средства.Курс лечения 5-7 дней.

Прогноз в большинстве случаев благоприятный, серьезный при миелитах и энцефалитах, неблагоприятный при энцефаломиокардитах новорожденных. Сроки потери трудоспособности зависят от клинической формы. При серозных менингитах стационарное ле­чение продолжается 2-3 нед, выписка производится после полного клинического выздоровления и санации спинномозговой жидкости.

Профилактика и мероприятия в очаге. В очаге проводится комплекс профилактических и противоэпидемических мероприятий, направленных на предупреждение инфекций с воздушно-капельным и фекально-оралъным механизмом передачи.Введение иммунного иммуноглобулина не дает выраженного профилактического эффекта. Специфическая профилактика не раз­работана. Срок изоляции 14 дней. Для детей, контактировавших с заболевшими, в детских учреждениях устанавливается карантин на 14 дней после прекращения контакта и дезинфекции. Работников родильных домов и детских учреждений, бывших в контакте с боль­ными, на 14дней переводят на другую работу.

Берегите свое здоровье и здоровье своих близких!

Врач инфекционист поликлиники №14
ГБУЗ «Городская поликлиника»  Федулаева С.В.


 

Вирусы Коксаки и ЕСНО пришли в Москву – Москва 24, 12.09.2017

Вирусы Коксаки и ECHO пришли в Москву. О первом подобном диагнозе, поставленном 9-месячному младенцу в столичной больнице, в середине августа сообщал МК. А переболевший экзотической болезнью горожанин Павел Ковбасюк поделился своей историей с порталом Москва 24. Эксперты утверждают, что в России к вспышкам вирусов могут быть не готовы.

Фото: ТАСС/ Руслан Шамуков

О своей болезни Павел Ковбасюк узнал случайно. По пути в спортзал почувствовал сильную слабость и вернулся домой. Оказалось, что у него поднялась температура – 38,5. Никаких других симптомов не было. Утром добавились боль в горле и насморк. А когда на ладонях и ступнях появились странные красные пятна, стало ясно – это не простуда.

Сначала Коксаки москвич диагностировал себе сам, пролистав список симптомов в интернете, но никто не верил, что он действительно мог заразиться Коксаки: ни он сам, ни его ближайшее окружение за рубежом в этом году не были.

Врачи сомнения развеяли и подтвердили диагноз. Причем в скорой помощи отметили – это далеко не первый и не единичный случай. Ковбасюк также обратил внимание на то, что в бумагах диагноз поставили общий: энтеровирус.

Позднее москвич выяснил, что среди его друзей этой заразой переболели уже четыре человека. Тем не менее, никто из них, как и Павел, за границей в этом году не был.

Чем опасны вирусы Коксаки и ECHO

Вирусы Коксаки и ECHO – это целая группа острых заболеваний – от легких лихорадок до миокардитов, менингоэнцефалитов и миалгий.
Инфекция передается воздушно-капельным путем. Также заразиться можно фекально-оральным путем и через воду и еду. Вирус размножается в кишечнике человека, и долгое время выделяется во внешнюю среду.

Больше всего подвержены заболеванию дети в возрасте от 3 до 10 лет. Малыши до 3 месяцев вне опасности, поскольку обладают врожденным иммунитетом. Дети старше 10 лет и взрослые заболевают в редких случаях, поскольку часто переносят инфекцию без клинических проявлений, в результате которой приобретают иммунитет к болезни.

Если вирус будет занесен в детский коллектив, инфекцию подхватят до 80% детей. Фото: портал Москва 24

Вирус быстро передается от больных к здоровым. Если он будет занесен в детский коллектив, инфекцию подхватят до 80% детей. Такие вспышки схожи с эпидемиями ОРВИ.

Существуют также 4 других типа энтеровируса, помимо Коксаки и ECHO. Два из них возбуждают респираторные кишечные заболевания, один – приводит к геморрагическому конъюнктивиту. «Вирус типа 71» – к менингитам и энцефалитам.

Вирусы Коксаки и ЕСНО уже давно в России

Владимир Студеникин

Профессор и доктор медицинских наук


По мнению главного научного сотрудника психоневрологического отделения НИИ педиатрии ГУ НЦЗД РАМН, профессора и доктора медицинских наук Владимира Студеникина, появление вирусов Коксаки и ЕСНО в России частично связано с отпускным периодом, когда в страну возвращаются отдыхающие из-за рубежа, а частично с тем, как легко заразиться Коксаки-инфекцией.

«Собственно говоря, они (вирусы – прим. Москва 24) не появились, а всегда были (описаны в США в 1948 году). Широкого распространения вируса Коксаки в нашей стране не ожидается, хотя это вполне возможно. Распознать инфицирование вирусом Коксаки несложно по характерным симптомам болезни. Например, синдром «рука-нога-рот» (болезненные язвы в полости рта и небольшие везикулы (сероватые пузырьки) на конечностях – прим. Москва 24) или герпетическая ангина», – пояснил доктор медицинских наук в беседе с порталом Москва 24.

Роспотребнадзор готов к оперативному предупреждению распространения энтеровирусной инфекции из Китая.

Лаборатории ведомства обеспечены диагностическими препаратами для проведения исследований на энтеровирусные инфекции и квалифицированным персоналом. Кроме того, медработников обучили методикам диагностики, лечения и профилактики таких инфекций.


Особой опасности вирусы Коксаки и ЕСНО не представляют, хотя инфекционные заболевания, вызванные этими вирусами, могут сопровождаться серьезными осложнениями. Но чаще всего болезнь проходит естественным путем по прошествии полутора-двух недель, добавил Студеникин.

Больше всего подвержены заболеванию дети в возрасте до 10 лет. Фото: ТАСС/Дмитрий Рогулин

«Специфического эффективного лечения для таких вирусных инфекций не существует, используется симптоматическая терапия и обильное питье. Вакцины не разработаны и иммунопрофилактика невозможна. Осложнениями коксаки-инфекции (самыми тяжелыми) являются менингит, миокардит, артрит (соответственно, поражение мозга, сердца или суставов)», – отметил профессор.

Уверенности в том, что в России готовы к вспышке вируса Коксаки, нет

Владимир Студеникин

Профессор и доктор медицинских наук


Он подчеркнул, что уверенности в том, что в Москве и в России готовы к возможным вспышкам этого заболевания, нет.

«До недавнего времени не только немедицинская общественность, но и многие врачи не имели какого-либо представления о вирусе Коксаки и ассоцированных с ним инфекциях», – заключил Студеникин.

Россиян предупреждают о возможной вспышке серозного менингита.

По данным Роспотребнадзора, смертельно опасное заболевание пришло из Китая. Первые случаи уже зафиксированы в шести регионах страны за Уралом и в центральной части.

Вирус поражает в основном детей. Главная особенность опасной болезни в том, что инкубационный период чрезвычайно короткий – всего сутки. Симптомами являются сонливость, высокая температура, головокружение, рвота, тяжесть в животе. В настоящий момент принимаются превентивные меры для выявления возможных заболевших.

Подробности – в сюжете телеканала Москва 24.


Кристина Оленева, Джо Халдон

Информация по энтеровирусной инфекции. | Городская детская поликника №6

Энтеровирусные инфекции у детей — острые инфекционные заболевания, возбудителями которых служат кишечные вирусы (энтеровирусы) из семейства пикорнавирусов. Клинические проявления энтеровирусной инфекции у детей полиморфны; заболевание может протекать в следующих формах: катаральной, гастроэнтеритической, энтеровирусной лихорадки, энтеровирусной экзантемы, герпангины, серозного менингита, миокардита, энцефаломиокардита новорожденных, конъюнктивита, увеита и др. Для обнаружения вирусов в биологических жидкостях используются методы ПЦР, ИФА, РПГА. Этиопатогенетическое лечение энтеровирусной инфекции у детей проводится интерферонами, иммуноглобулинами и другими препаратами.

    • Причины энтеровирусной инфекции у детей
    • Классификация энтеровирусной инфекции у детей
    • Симптомы энтеровирусной инфекции у детей
    • Диагностика энтеровирусной инфекции у детей
    • Лечение энтеровирусной инфекции у детей
    • Прогноз и профилактика энтеровирусной инфекции у детей
    • Цены на лечение

Энтеровирусная инфекция у детей


Энтеровирусные инфекции у детей – обширная группа заболеваний, вызываемых РНК-содержащими неполиомиелитными вирусами (Коксаки, ECHO, неклассифицированными энтеровирусами человека) и полиовирусом. В силу специфичности вызываемых поражений, полиомиелит стоит несколько обособленно в ряду энтеровирусных инфекций у детей, поэтому рассматривается нами отдельно. В рамках данного обзора остановимся на энтеровирусных инфекциях неполиомиелитной этиологии, распространенных среди детей.
Наряду с ОРВИ, энтеровирусные инфекции встречаются в педиатрии довольно часто. Ежегодно среди общего количества больных энтеровирусной инфекцией удельный вес детей составляет 80-90%; из них половина случаев заболевания приходится на детей младшего возраста. Учитывая полиморфизм клинических проявлений, энтеровирусные инфекции у детей представляют интерес не только для специалистов в области инфекционных болезней, но иневрологии, гастроэнтерологии, кардиологии, офтальмологии, отоларингологии.

Причины энтеровирусной инфекции у детей

Возбудителями энтеровирусных инфекций неполиомиелитной этиологии у детей выступают вирусы Коксаки А (24 серотипа), Коксаки В (6 серотипов), ECHO (34 серотипа) и неклассифицированные энтеровирусы человека 68-71 серотпипов. Всех неполиомиелитных энтеровирусов объединяет устойчивость к низким температурам (замораживанию, оттаиванию) и быстрая инактивация в условиях высокой температуры (при кипячении) или воздействии хлорсодержащих растворов, йода, формалина, перекиси водорода, УФО.
Источниками энтеровирусной инфекции могут служить дети и взрослые, являющиеся вирусоносителями или больными манифестной формой заболевания. Передача инфекции от человека к человеку осуществляется воздушно-капельным или фекально-оральным путями; реже отмечается трансплацентарная передача. Сезонные подъемы заболеваемости энтеровирусными инфекциями среди детей отмечаются в конце лета – начале осени. Наибольшая заболеваемость регистрируется среди детей в возрасте от 3 до 10 лет. Взрослые и дети старшего возраста заболевают реже, что объясняется наличием у них иммунитета, сформировавшегося вследствие бессимптомной инфекции. Наряду со спорадическими случаями и эпидемическими вспышками энтеровирусной инфекции в детских коллективах, встречаются крупные эпидемии, поражающие целые регионы.
Проникновение энтеровирусов в организм происходит через слизистые оболочки пищеварительного и респираторного тракта. Репликация вирусов происходит в лимфоидной ткани, эпителии ротоглотки и ЖКТ, поэтому ранними клиническими проявлениями энтеровирусной инфекции у ребенка могут быть герпетическая ангина, фарингит, диарея и пр. Дальнейшее распространение вирусов по организму происходит гематогенным путем. Обладая органотропностью, энтеровирусы могут поражать нервную ткань, мышцы, покровные ткани, сосуды глаз и т. д. После перенесенной энтеровирусной инфекции у детей формируется типоспецифический иммунитет к тому серологическому типу вируса, которым было вызвано заболевание.

Классификация энтеровирусной инфекции у детей

В зависимости ведущего клинического синдрома, различают типичные и атипичные энтеровирусные инфекции у детей. Типичные формы могут проявляться в виде изолированных или комбинированных поражений: герпетической ангины, катара верхних дыхательных путей,гастроэнтерита, эпидемической миалгии, энтеровирусной лихорадки, энтеровирусной экзантемы, гепатита. Поражение нервной системы при энтеровирусной инфекции у детей может протекать по типу энцефалита, серозного менингита, энцефаломиокардита новорожденных, параличей; поражение сердца – в виде миокардита и перикардита; поражение глаз – в виде геморрагического конъюнктивита и увеита; поражение мочеполовой системы – в форме геморрагического цистита, орхита, эпидидимита. К атипичным формам энтеровирусной инфекции у детей относятся случаи стертого и бессимптомного течения.
С учетом выраженности клинических признаков энтеровирусная инфекция у детей может иметь легкое, среднетяжелое и тяжелое течение. Критериями степени тяжести выступают выраженность местных изменений и интоксикационного синдрома. По характеру течения энтеровирусные инфекции у детей подразделяются на неосложненные и осложненные.

Симптомы энтеровирусной инфекции у детей

Несмотря на полиморфизм клинических проявлений, течению различных энтеровирусных инфекций у детей свойственны некоторые общие черты. Длительность инкубационного периода составляет от 2 до 10 дней (в среднем 2-4 дня). Манифестация заболевания происходит остро, с высокой лихорадки (39-40 °С), озноба, головной боли, слабости, нарушения сна, отсутствия аппетита, повторной рвоты.
При любой форме энтеровирусной инфекции у детей отмечается гиперемия кожи лица, шеи и верхней половины туловища, инъекция сосудов конъюнктивы и склеры. Возможно появление полиморфной пятнисто-папулезной сыпи, гиперемии слизистой миндалин дужек и задней стенки глотки, шейного лимфаденита. Считается, что внутриутробное инфицирование энетровирусами может послужить причиной синдрома внезапной детской смерти. Также доказана связь между энтеровирусной инфекцией у детей и развитием сахарного диабета 1 типа.
Кроме общей симптоматики, в клинике различных форм энтеровирусной инфекции у детей присутствуют свои специфические проявления.
Энтеровирусная лихорадка у детей (малая болезнь, летний грипп, трехдневная лихорадка) вызывается разными серотипами вирусов Коксаки и ECHO. Для инфекции характерна острая манифестация с лихорадки, миалгии, умеренных катаральных явлений. У ребенка выражены общие признаки энтеровирусной инфекции: инъекция сосудов склер, гиперемия лица, увеличение лимфоузлов и др.; может отмечаться увеличение печени и селезенки. Данная форма энтеровирусной инфекции у детей протекает легко, обычно не более 2-4 дней. В редких случаях энтеровирусная лихорадка продолжается 1-1,5 недели или имеет волнообразное течение.
Кишечная (гастроэнтеритическая) форма энтеровирусной инфекции чаще встречается у детей до 3-х лет. Заболевание протекает с незначительными катаральными явлениями (ринитом, заложенностью носа, гиперемией слизистых ротоглотки, кашлем) и диспепсическим синдромом (диареей, рвотой, метеоризмом). Тяжелая интоксикация, дегидратация и явленияколита не свойственны. Продолжительность кишечной формы энтеровирусной инфекции у детей составляет 1-2 недели.
Катаральная (респираторная) форма энтеровирусной инфекции у детей протекает по типу ОРЗ. Отмечается кратковременная лихорадка, ринофарингит, ларингит. Возможно развитие синдрома ложного крупа.
Энтеровирусная экзантема, ассоциированная с ECHO и Коксаки-вирусами, характеризуется появлением на высоте лихорадки кожной сыпи. По характеру сыпь может напоминать таковую при скарлатине, кори или краснухе; элементы располагаются преимущественно на коже лица и туловища. Реже встречаются пузырьковые высыпания в полости рта, напоминающие герпес(пузырчатка полости рта). Течение энтеровирусной инфекции у детей благоприятное; сыпь и лихорадка исчезают в течение 1-2 дней.
Эпидемическая миалгия (болезнь Борнхольма, плевродиния) – энтеровирусная инфекция у детей, вызываемая Коксаки и ECHO-вирусами. Ведущим проявлением заболевания служат интенсивные мышечные боли, сопровождающие высокую лихорадку. Чаще дети жалуются на боли в грудной клетке и верхней половине живота, реже – в спине и конечностях. При движении боли усиливаются, вызывая побледнение кожных покровов, обильное потоотделение, тахипноэ. Эпидемическая миалгия требует проведения дифференциальной диагностики с плевритом,острым аппендицитом или перитонитом. Вне болевого приступа дети чувствуют себя значительно лучше. Данная форма энтеровирусной инфекции у детей нередко протекает совместно с герпангиной и серозным менингитом.
Серозный менингит является типичной формой энтеровирусной инфекции у детей. Клиническая картина характеризуется высокой температурой тела, сильной головной болью, повторной рвотой, беспокойством и возбуждением ребенка, бредом и судорогами. Со стороны респираторного тракта отмечаются явления фарингита. С первых дней выражены менингеальные симптомы: положительные симптомы Брудзинского и Кернига, ригидность мышц затылка. Обычно через 3-5 дней симптоматика регрессирует, однако постинфекционная астенияи остаточные явления могут сохраняться в течение 2-3 месяцев.
Полиомиелитоподобная (паралитическая) форма энтеровирусной инфекции у детей является одной из наиболее тяжелых. Как и при полиомиелите, повреждение передних рогов спинного мозга может приводить к развитию вялых параличей и парезов нижних конечностей. В легких случаях прихрамывающая походка, слабость в ногах, снижение мышечного тонуса являются обратимыми и постепенно исчезают через 4-8 недель. При тяжелых формах энтеровирусной инфекции у детей возможен летальный исход вследствие нарушением функции дыхательного и сосудодвигательного центров.
Энцефаломиокардит новорожденных вызывается вирусами Коксаки типа В и характерен длянедоношенных и детей первых месяцев жизни. На фоне общей симптоматики (вялости, отказа от груди, субфебрилитета) нарастают явления сердечной недостаточности (тахикардия, одышка, цианоз, аритмия, расширение границ сердца и печени). При энцефалите развивается выбухание родничков и судороги. Летальность при данной форме энтеровирусной инфекции среди детей достигает 60-80%.
Геморрагический конъюнктивит вызывается энтеровирусом типа 70. Проявляется светобоязнью, слезотечением, ощущением инородного тела в глазах. Объективно определяются отек и гиперемия конъюнктивы, точечные кровоизлияния. При присоединении вторичной инфекции может развиваться бактериальный конъюнктивит, кератит. Обычно все симптомы энтеровирусной инфекции у детей стихают через 10-14 дней.
Энтеровирусный увеит преимущественно поражает детей 1-го года жизни. Данная форма энтеровирусной инфекции протекает с лихорадкой, интоксикацией, кишечным и респираторным синдромом. Поражение сосудистой оболочки глаза носит стойкий характер и может привести к дистрофии радужки, помутнению роговицы, развитию увеальной катаракты и глаукомы, субатрофии глазного яблока.
Особенности течения герпетической ангины проанализированы в соответствующем обзоре.

Диагностика энтеровирусной инфекции у детей

Энтеровирусные инфекции у детей диагностируются на основании типичного симптомокомплекса с учетом сезонности и эпидемиологических данных. Обязательным для установления диагноза является лабораторное подтверждение энтеровирусной инфекции у детей: обнаружение РНК энтеровируса методом ПЦР, определение титра специфических антител с помощью ИФА, РСК или РПГА и др.
Лабораторная верификация возбудителей может проводиться в различных биологических жидкостях: в крови, отделяемом конъюнктивы, смыве из носоглотки, соскобах с кожных высыпаний, образцах фекалий, спинномозговой жидкости (при наличии показаний длялюмбальной пункции), биоптатах органов и др.
В зависимости от ведущего клинического синдрома дети могут нуждаться в консультации педиатра, детского кардиолога, детского невролога, детского отоларинголога, детского офтальмолога и др. специалистов.
Различные формы энтеровирусной инфекции у детей требуют проведения дифференциальной диагностики с полиомиелитом, корью, краснухой, скарлатиной, эпидемическим паротитом, ОРВИ, ОКИ.
Лечение энтеровирусной инфекции у детей
Лечение легких изолированных форм энтеровирусной инфекции у детей проводится амбулаторно; госпитализация требуется при серозном менингите, энцефалите, миокардите, тяжелых комбинированных поражениях. В лихорадочном периоде показаны покой, постельный режим, достаточный питьевой режим.
Этиопатогенетическая терапия энтеровирусной инфекции у детей включает применение рекомбинантных интерферонов (альфа интерферона), интерфероногенов ( оксодигидроакридинилацетата, меглюмина акридонацетата), полиспецифических иммуноглобулинов (при тяжелом течении).
При миокардите, менингите и др. формах показано назначение глюкокортикостероидов. Одновременно проводится симптоматическое лечение (прием жаропонижающих, дезинтоксикационная терапия, орошение полости носа, полоскание зева и др.).

Прогноз и профилактика энтеровирусной инфекции у детей

В большинстве случаев энтеровирусная инфекция у детей заканчивается реконвалесценцией. Наиболее серьезными в отношении прогноза являются энтеровирусные энцефалиты, энцефаломиокардиты новорожденных, менингиты, генерализованная инфекция, присоединение бактериальных осложнений.
Дети, заболевшие энтеровирусной инфекцией, подлежат изоляции; на контактных лиц накладывается карантин на 2 недели. В эпидемиологическом очаге проводятся дезинфекционные мероприятия. Ввиду большого разнообразия энтеровирусов специфическая вакцина против инфекции не разработана. Неспецифическая профилактика включаетэндоназальную инстилляцию лейкоцитарного интерферона детям и взрослым, контактировавшим с больным энтеровирусной инфекцией.
Источник: http://www.krasotaimedicina.ru/diseases/children/enterovirus-infection

Скачать данную статью.

СОВРЕМЕННЫЕ ВОЗМОЖНОСТИ ДИАГНОСТИКИ, ПРОФИЛАКТИКИ И ЛЕЧЕНИЯ ЭНТЕРОВИРУСНОЙ ИНФЕКЦИИ КОКСАКИ У ДЕТЕЙ | Ботвиньева

1. Сейбиль В. Б., Малышкина Л. П. Всемирная организация здравоохранения и проблема ликвидации инфекционных заболеваний в мире. Вопросы вирусологии. 2005; 50: 3.

2. Амвросьева Т. В., Богуш З. Ф. и др. Вспышка энтеровирусной инфекции в Витебске в условиях загрязнения питьевой воды. Вопросы вирусологии. 2004; 1: 7–9.

3. Ежлова Е. Б., Чернявская О. П., Михайлов М. И. Эпидемио логический надзор и профилактика энтеровирусной (неполио) инфекции. Методические указания 3.1.1.2363-08. Москва. 2008.

4. Кузнецова В. Г., Мечетина А. А. и др. Клинико-эпидемиологическая характеристика энтеровирусного менингита по данным вспышки 2004 года. Сборник материалов XV Научно-практической конференции врачей. Новосибирск. 2005. С. 415–416.

5. Лашкевич В. А., Дроздов С. Г., Грачев В. П. и др. Неполиомиелитные энтеровирусные инфекции: Эпидемиология, характеристика энтеровирусов, клиника, диагностика, профилактика. Методическое пособие. Федеральный центр Госсанэпиднадзора РФ. Москва. 2004.

6. Melnick J. L., Shaw E. W., Curnen E. C. A virus irom patients diagnosed as non-paralytic poliomyelitis or aseptic meningitis. Proc. Soc. Exp. Biol. 1949; 71: 344–349.

7. Abubakar S., Chee H. Y., Shafee N. et al. Molecular detection of enteroviruses from an outbreak of hand, foot and mouth disease in Malaysia in 1997. Scand. J. Infect. Dis. 1999; 31 (4): 331–335.

8. Ang L. W., Koh B.K., Chan K. P. et al. Epidemiology and control of hand, foot and mouth disease in Singapore, 2001–2007. Ann. Acad. Med. Singapore. 2009; 38 (2): 106–112.

9. Энтеровирусные заболевания: клиника, лабораторная диагностика, эпидемиология, профилактика. Методические указания (МУ 3.1.1.2130-06). Москва. 2006.

10. Ding N. Z., Wang X. M., Sun S. W. et al. Appearance of mosaic enterovirus 71 in the 2008 outbreak of China. Virus Res. 2009; 45 (1): 157–161.

11. Osterback R., Vuorinen T., Linna M. et al. Coxsackievirus A6 and hand, foot and mouth disease, Finland. Emerg. Infect. Dis. 2009; 15 (9): 1485–1488.

12. Yamashita T., Ito M., Taniguchi A., Sakae K. Prevalence of coxsackievirus A5, A6, and A10 in patients with herpangina in aichi prefecture. J. Infect. Dis. 2005; 58: 390–391.

13. Бочаров Е. Ф., Ерман Б. А., Фомин В. В. и др. Энтеровирусная инфекция: Новые аспекты. Новосибирск: Наука. Сибирское отделение РАМН. 1990. С. 224.

14. Лозовская Л. С. и др. Значение вертикальной передачи энтеровирусов в эпидемиологии врожденных вирусных инфекций. Акушерство и гинекология. 1995; 2: 26–30.

15. Mori M., Takagi K., Kuwabara S. et al. Guillain-Barre syndrome following hand-foot-and-mouth disease. Intern. Med. 2000; 39 (6).

16. Cabral L. A., Almeida J. D., de Oliveria M. L., Meza A. C. Hand, foot and mouth disease: a case report. Quintessence Int. 1998; 29: 194–196.

17. Злобин В. И. Энтеровирусные инфекции. Инфекционные болезни. 1999. С. 302–307.

18. Демина А. В., Маркович Н. А., Нетесов С.В. Энтеровирусы. Часть 1. История открытия, таксономия, строение генома, эпидемиология. Бюллетень СО РАМН. 2008; 1 (129): 92–100.

19. Демина А. В. и др. Энтеровирусы. Часть 2. Энтеровирусные инфекции: Многообразие клинических проявлений. Бюллетень СО РАМН. 2009; 6 (140): 116–125.

20. Лобзин Ю. В., Пилипенко В. В., Громыко Ю. Н. Менингиты и энцефалиты. СПб.: Фолиант. 2001. С. 55–110.

21. Михайлов Е. В., Штейнберг А. В., Еремеева И. Г. Менингиты энтеровирусной этиологии у детей: Современные подходы к диагностике и особенности клинического течения. Инфекционные болезни. 2008; 6 (1): 31–34.

22. McMinn P., Stratov I., Nagarajan L., Davis S. Neurological manifestations of enterovirus 71 infection in children during an outbreak of hand, foot, and mouth disease in western australia. Clin. Infect. Dis. 2001; 32 (2): 236–242.

23. Nix W. A., Oberste M. S., Pallansch M. A. Sensitive, seminested PCR amplification of VP1 sequences for direct identification of all enterovirus serotypes from original clinical specimens. J. Clin. Microbiol. 2006; 44 (8): 2698–2704.

24. Logotheti M., Pogka V., Horefti E. et al. Laboratory investigation and phylogenetic analysis of enteroviruses involved in an aseptic meningitis outbreak in greece during the summer of 2007. J. Clin. Virol. 2009; 46 (3): 270–274.

25. Sasidharan C. K., Sugathan P., Agarwal R. et al. Hand-foot-andmouth disease in calicut. Indian J. Pediatr. 2005; 72 (1): 17–21.

26. Tu P., Thao N., Perera D. et al. Epidemiologic and virologic investigation of hand, foot, and mouth disease, southern vietnam, 2005. Emerging Infectious Diseases. 2007; 13 (11).

27. Zhang Y., Nan L. J., Wu G. S. et al. The epidemiologic and virological analysis of an outbreak of hand, foot, and mouth disease in inner Mongolia in 2007. Bing Du Xue Bao. 2009; 25 (3): 159–165.

Медицинские новости — БУЗ РА «Турочакская ЦРБ»

Понедельник,  9  Июль  2018


Энтеровирусная инфекция

История и распространение. Первые представители вирусов Коксаки были выделены в 1948 г, в г. Коксаки (США) от больных полиомиелитоподобными заболеваниями. В 1951 г. Эндерс из фекалий выделил группу вирусов, обладавших цитопатогенным действием. Однако их роль в патологии человека была неизвестна, поэтому им было дано название «вирусы ECHO» (аббревиатура английского названия Enteric Cytopathogenic Human Orphan — «кишечные цитопатогенные человеческие сиротки»). В последующие годы было установлено, что обе группы вирусов близки по своим свойствам к вирусам полиомиелита и вызывают многообразные по клиническим проявлениям заболевания (например, ОРВИ, диарею, герпангину, менингит и др.). В последние годы наметилась четкая тенденция активизации энтеровирусной инфекции в мире, о чем свидетельствуют постоянно регистрируемые в разных странах эпидемиологические подъемы заболеваемости и вспышки. География энтеровирусных инфекций чрезвычайно широка и охватывает все страны мира, в том числе и постсоветского пространства. Так, в научной литературе описаны вспышки энтеровирусного (асептического) менингита во Франции (2002 г., 559 случаев, вирусы ECHO 13, 20, 6), в Японии (2000 г., заболело несколько сотен человек, были смертельные исходы, энтеровирус 71-го типа), США (2001 г., более 100 заболевших, вирус ECHO 13), Испании (2000 г., 135 случаев, вирус ECHO 13), Германии (2001 г., заболело 70 человек, вирус Коксаки В5), Турции. Наиболее крупные из описанных вспышек отмечались на Тайване (1998, 2000 гг., заболело около 3 тысяч человек, преобладали вирусы ECHO 13, 30, энтеровирус 71-го типа) и в Сингапуре (2000 г., 1 тысяча случаев, 4 смертельных исхода, вспышка вызвана энтеровирусом 71-го типа), Тунисе (2003 г., 86 человек, представлена вирусами ECHO 6, 13). На постсоветском пространстве наиболее крупные вспышки в последние годы наблюдались в России, в Приморском крае (Хабаровск, 1997 г., преобладали вирусы Коксаки В3, 4, 5, EСНО 6, 17, энтеровирус 70-го типа) и в Калмыкии (2002 г., 507 случаев, вирус ECHO 30), а также в Украине (1998 г., заболело 294 человека, вирус Коксаки В4).

Одной из основных особенностей этих инфекций является здоровое вирусоносительство, постоянно обусловливающее возникновение спорадических форм и массовых заболеваний, которое, как и заболеваемость, наблюдается не только среди детей младшего и старшего возраста, но и среди взрослых. Установлено, что продолжительность пребывания энтеровирусов в кишечнике не превышает 5 месяцев.

Энтеровирусные инфекции (Enterovirosis) — большая группа антропонозных

инфекционных болезней с фекально-оральным механизмом передачи возбудителя, вызываемых энтеровирусами группы Коксаки и ECHO, которые характеризуются полиморфизмом клинической картины (с поражением ЦНС, мышц, слизистых оболочек и кожи).

Этиология

Источник энтеровирусов — человек (больной или вирусоноситель). В распространении заболевания большую роль играют реконвалесценты, а также лица, находившиеся в контакте с больными и реконвалесцентами.

Основной механизм передачи возбудителя — фекально-оральный, главные

пути передачи — водный и алиментарный. Чаще всего факторами передачи становятся вода,овощи, реже молоко и другие пищевые продукты. Возможно заражение при купании в водоёмах, контаминированных энтеровирусами. Вирус может передаваться через грязные руки, игрушки. Учитывая, что в остром периоде вирус выделяется из носоглоточной слизи, не исключён и воздушно-капельный путь передачи. Возможна трансплацентарная передача энтеровирусов от больной матери плоду.

Восприимчивость высокая. Часто наблюдаются групповые заболевания в детских учреждениях, возможны семейные вспышки. Бессимптомное вирусоносительство встречается в 17–46% случаев (чаще у детей младшего возраста). После перенесённой энтеровирусной инфекции вырабатывается стойкий типоспецифический иммунитет.

Энтеровирусные инфекции распространены повсеместно. В связи с резким снижением в последние годы заболеваемости полиомиелитом эпидемиологическое значение энтеровирусных инфекций возрастает.

Патогенез

Патогенез энтеровирусных инфекций изучен недостаточно, так как вирусы могут размножаться в стенке кишки, не вызывая заболевания. Болезнь возникает при снижении резистентности организма. Энтеровирусы проникают в организм через слизистую оболочку верхних отделов дыхательных путей и пищеварительного тракта, где и происходит их первичное накопление. При выходе вируса за пределы зоны первоначального накопления он попадает в регионарные лимфатические узлы и лимфатические образования кишечника, где продолжается его репликация. На 3-й день от начала болезни в результате первичной виремии поражаются другие органы. Многообразие клинических форм энтеровирусной инфекции объясняют, как мутацией капсидных антигенов, гетерогенностью вирусной популяции, так и тропностью различных генотипов возбудителя к отдельным тканям (эпителиальным клеткам, нервной ткани и мышцам). В 1–2% случаев одновременно с поражением других органов или несколько позже возможно вовлечение в процесс ЦНС. Проникнув в ЦНС, вирус воздействует на сосудистые сплетения головного мозга, вследствие чего вырабатывается избыточное количество СМЖ с развитием гипертензивногидроцефального синдрома, раздражением ядер блуждающего нерва и рвотного центра. В зависимости от уровня поражения ЦНС развиваются серозный менингит, менингоэнцефалит или полиомиелитоподобное заболевание. К поражению ЦНС приводят энтеровирусы, обладающие повышенной тропностью к нервной ткани.

У беременных в результате виремии возможно внутриутробное поражение плода. Энтеровирусная инфекция может протекать бессимптомно с персистенцией вирусов в кишечнике, мышцах, паренхиматозных органах, ЦНС. Возможно и хроническое течение инфекции.

Классификация

По типу:

1. Типичные:

а) изолированные:

— герпангина;

— эпидемическая миалгия;

— поражение нервной системы;

— энтеровирусная лихорадка;

— энтеровирусная экзантема;

— кишечная форма;

— респираторная форма;

— поражения сердца;

— поражения глаз;

б) комбинированные:

— герпангина и миалгия;

— герпангина и серозный менингит и др.

2. Атипичные:

— стертая;

— бессимптомная.

По тяжести:

1. Легкая форма.

2. Среднетяжелая форма.

3. Тяжелая форма.

Критерии тяжести:

— выраженность синдрома интоксикации;

— выраженность местных изменений.

По течению (по характеру):

1. Гладкое.

2. Негладкое:

— с осложнениями;

— с наслоением вторичной инфекции;

— с обострением хронических заболеваний

Клиника

Инкубационный период продолжается от 2 до 10 дней (чаще 2 — 4 дня).

Часто отмечается тошнота, повторная рвота. При всех формах выявляются гиперемия кожных покровов верхней половины туловища (особенно лица и шеи), инъекция сосудов склер, на коже может появляться экзантема полиморфного характера. В зеве наблюдаются гиперемия небных дужек, мягкого неба, язычка и зернистость задней стенки глотки.

 

 

 

 

 

 

 

Диагностика

Окончательно устанавливают диагноз при помощи серологических исследований и выделения вируса из носоглоточной слизи, СМЖ, фекалий, крови. Высокой эффективностью отличается метод ПЦР.

Лечение

Этиотропные средства отсутствуют. Проводят дезинтоксикационную и симптоматическую терапию.

Меры профилактики

Специфические

Специфическая профилактика не разработана.

Неспецифические

В качестве неспецифической профилактики детям до 3 лет, контактировавшим с больными, вводят человеческий, а также в течение 7 дней закапывают в нос лейкоцитарный интерферон. В эпидемиологическом очаге проводят профилактические и противоэпидемические мероприятия. Больных изолируют на 14 дней; проводят влажную уборку помещений с использованием дезинфицирующих средств (0,1% раствор хлористоводородной кислоты, 0,3% раствор формальдегида). В детских учреждениях устанавливают карантин на 14 дней. Работников родильных домов и детских учреждений, контактировавших с больными, переводят на другую работу на 14 дней.

Прогноз

У подавляющего большинства больных при поражениях кожи и слизистых оболочек прогноз благоприятный. Заболевание заканчивается полным выздоровлением. Тяжёлое течение с летальным исходом возможно при энцефаломиокардите новорождённых, энцефалитах и менингоэнцефалитах, паралитической форме энтеровирусной инфекции, реже при эпидемической миалгии.

 


Энтеровирусная инфекция у детей: клиника, диагностика, подходы к терапии

Внедрение в широкую практику в конце 50-х годов ХХ века оральной полиомиелитной вакцины А. Сэбина позволило в короткие сроки прекратить эпи­демию полиомиелита. Это оказало неспецифическое, но существенное влияние на распространение возбудителей энтеровирусных инфекций (ЭВИ), благодаря чему сократилось число эпидемий. Энтеровирусы (ЭВ) вызывают малопредсказуемые заболевания у людей. Вирус одного и того же серотипа способен вызывать совершенно разные клинические синдромы: от тяжелых паралитических заболеваний с высокой летальностью до легких лихорадочных состояний.

 

В последние годы наметилась четкая тенденция активизации ЭВИ в мире, о чем свидетельствуют по­стоянно регистрируемые в разных странах эпидемио­логические подъемы заболеваемости и вспышки [1]. География ЭВИ чрезвычайно широка и охватывает все страны мира, в том числе и постсоветского пространства. Так, в научной литературе описаны вспышки энтеровирусного (асептического) менингита во Франции (2002 г., 559 случаев, вирусы ECHO 13, 20, 6), в Японии (2000 г., заболело несколько сотен человек, были смертельные исходы, энтеровирус 71-го типа), США (2001 г., более 100 заболевших, вирус ECHO 13), Испании (2000 г., 135 случаев, вирус ECHO 13) [3, 4], Германии (2001 г., заболело 70 человек, вирус Коксаки В5) [5, 6], Турции [7, 8]. Наиболее крупные из описанных вспышек отмечались на Тайване (1998, 2000 гг., заболело около 3 тысяч человек, преобладали вирусы ECHO 13, 30, энтеровирус 71-го типа) [9] и в Сингапуре (2000 г., 1 тысяча случаев, 4 смертельных исхода, вспышка вызвана энтеровирусом 71-го типа) [10], Тунисе (2003 г., 86 человек, представлена вирусами ECHO 6, 13) [14]. На постсоветском пространстве наиболее крупные вспышки в последние годы наблюдались в России, в Приморском крае (Хабаровск, 1997 г., преобладали вирусы Коксаки В3, 4, 5, EСНО 6, 17, энтеровирус 70-го типа) [11] и в Калмыкии (2002 г., 507 случаев, вирус ECHO 30) [12], а также в Ук­раине (1998 г., заболело 294 человека, вирус Коксаки В4) [13].

 

Одной из основных особенностей этих инфекций является здоровое вирусоносительство, постоянно обусловливающее возникновение спорадических форм и массовых заболеваний, которое, как и заболеваемость, наблюдается не только среди детей младшего и старшего возраста, но и среди взрослых. ­Установлено, что продолжительность пребывания энте­ровирусов в кишечнике не превышает 5 месяцев.

 

Однако основное значение в поддержании циркуляции энтеровирусов среди населения, по-видимому, имеют два фактора — наличие восприимчивых контингентов и значительная длительность вирусоносительства. Последняя особенность позволяет вирусу после инфицирования неиммунных лиц, создавая высокоиммунную прослойку, дождаться новых восприимчивых контингентов.

Этиологические особенности энтеровирусной инфекции

Современная классификация энтеровирусов была разработана в 2000 году на основании накопленных к этому времени данных о генетической структуре и филогенетических взаимоотношениях разных представителей рода Enterovirus. В данный род входит семейство Picornoviridae, которое, в свою очередь включает 5 видов неполиомиелитных энтеровирусов, а именно Enterovirus А, В, С, Д, Е. Полио­вирусы по данной классификации составляют отдельный вид в составе рода Enterovirus. В состав вида А входят вирусы Коксаки А2–8, 10, 12, 14, 16 и энтеровирус 71.

 

Вид Enterovirus В является самым многочисленным и включает все вирусы Коксаки В и ЕСНО, за исключением ЕСНО 1, а также вируса Коксаки А9 и энтеровирусов 69, 73, 77, 78-го типов. Вид Enterovirus С объединяет оставшихся представителей вирусов Коксаки А, в том числе 1, 11, 13, 15, 17–22, 24-го типов. Виды Enterovirus D и Е сравнительно немногочисленны и включают 2 (Enterovirus68 и 70) и 1 (А2 plaque virus) представителя соответственно. Кроме того, в состав рода входит значительное количество неклассифицируемых энтеровирусов. Таким образом, род Enterovirus включает в себя более 100 опасных для человека вирусов. Они распространены повсеместно и высокоустойчивы к воздействиям физико-химических факторов.

 

Эпидемиологические особенности энтеровирусной инфекции

 

ЭВИ относятся к группе антропонозов. Существование ЭВ в природе обусловлено наличием двух основных резервуаров — человека, у которого происходит размножение и накопление вируса, и внешней среды (вода, почва, пищевые продукты), в которой они способны выживать благодаря высокой ­устойчивости [2]. Риск возникновения вспышек значительно возрастает при «вбросе» в человеческую популяцию массивного энтеровирусного загрязнения, что чаще всего может быть реализовано через водный и пищевой путь передачи.

 

Описывается вертикальный путь передачи ЭВИ. Высокий риск врожденной энтеровирусной инфекции, как правило, определяется не острым энтеровирусным заболеванием, перенесенным матерью во время беременности, а наличием у женщины персис­тентной формы энтеровирусной инфекции. С врожденной энтеровирусной инфекцией связывают синдром внезапной детской смерти.

 

Клинические формы энтеровирусной инфекции

 

Широкая пантропность энтеровирусов лежит в основе большого разнообразия вызываемых ими клинических форм инфекции, затрагивающих практически все органы и ткани организма человека: нервную, сердечно-сосудистую системы, желудочно-кишечный, респираторный тракт, а также почки, глаза, мышцы кожи, слизистую полости рта, печень, эндокринные органы. Особую опасность ЭВИ представляет у иммунодефицитных лиц.

 

Большинство случаев ЭВИ протекает бессимптомно. Большая часть клинически заметных проявлений — простудоподобные заболевания, причем энтеровирусы считаются вторым по частоте возбудителем ОРВИ [1].

 

Условно можно выделить две группы заболеваний, вызываемых ЭВ:

 

I. Потенциально тяжелые:

 

— серозный менингит;

 

— энцефалит;

 

— острый паралич;

 

— неонатальные септикоподобные заболевания;

 

— мио-(пери-)кардит;

 

— гепатит;

 

— хронические инфекции иммунодефицитных лиц.

 

II. Менее опасные:

 

— трехдневная лихорадка с сыпью или без;

 

— герпангина;

 

— плевродиния;

 

— везикулярный фарингит;

 

— конъюнктивит;

 

— увеит;

 

— гастроэнтерит.

 

Высокая тропность ЭВ к нервной системе характеризуется многообразием клинических форм наиболее часто встречающихся поражений нервной системы: серозных менингитов, энцефалитов, полирадикулоневритов, невритов лицевого нерва.

 

Ведущее место среди детских нейроинфекций по-прежнему занимают менингиты, которые составляют 70–80 % от общего числа инфекционных ­поражений центральной нервной системы. Ежегодно отмечается повышение заболеваемости энтеровирусными менингитами в летне-осенний период. Болеют преимущественно дети дошкольного и школьного возраста. Клинически асептический серозный менингит, вызванный разными типами полиовирусов, вирусов ЕСНО, вирусами Коксаки А и В, практически невозможно различить. Изменения цереброспинальной жидкости также неотличимы. К настоящему времени наиболее часто встречающаяся клиническая форма ЭВИ-менингита хорошо описана [16].

 

По данным ВОЗ, энтеровирусные инфекции серд­ца (ЭВИС) являются регулярно регистрируемой в мире патологией. В зависимости от возбудителя ЭВИС имеют вполне определенную долю в структуре общей инфекционной заболеваемости, составляющую около 4 % от общего числа зарегистрированных вирусных заболеваний. Наибольшее число ЭВИС обусловлено вирусами Коксаки В, второе место среди возбудителей ЭВИС (по удельному весу в инфекционной патологии) занимают вирусы Коксаки А, далее следуют вирусы ECHO и полиовирусы.

 

Выделяют следующие клинические формы вирусиндуцированных сердечных заболеваний: мио-, пери-, эндокардит, кардиомиопатии, врожденный и приобретенный пороки сердца [15]. Клинические проявления ЭВИС зависят от степени вовлечения миокарда в патологический процесс и могут сопровождаться как практически полным отсутствием нарушений функциональной активности миокарда, так и тяжелым поражением сердечной деятельности, сопровождающимся дилатацией всех камер сердца со значительным нарушением систолической функции. Энтеровирусы обладают высокой тропностью к тканям сердца, в которых сначала развиваются альтернативно-деструктивные процессы, обусловленные прямым цитопатическим действием вируса, а в по­следующем возникает вирусиндуцированное воспаление с формированием мио-, эндо- и эпикардита, диффузного кардиосклероза, приводящих к развитию дилатационной кардиомиопатии.

 

Интерес представляют сообщения о сосудистых поражениях при Коксаки-инфекциях, выявленных у больных с ЭВИ-миокардитами.

 

Энтеровирус 70 в последние годы вызвал многочисленные вспышки острого эпидемического гемо­ррагического конъюнктивита, склонного к распрост­ранению. У некоторых пациентов через промежуток времени от начала заболевания развивались параличи и парезы различной выраженности и локализации. Встречаются увеиты, вызванные ЕСНО 11, 19.

 

Наибольшую опасность энтеровирусные инфекции представляют для иммуносупрессивных лиц: больных со злокачественными заболеваниями крови, новорожденных, лиц после трансплантации костного мозга, ВИЧ-инфицированных больных.

 

Инфекция, вызванная вирусом Коксаки А9, связана с развитием аутоиммунных заболеваний. Доказана роль энтеровирусов в развитии диабета 1-го типа.

 

В литературе обсуждается вопрос о роли энтеровирусных инфекций, в частности Коксаки-вирусной, в этиологии самопроизвольных выкидышей [17].

 

Поражение половой сферы проявляется клиникой паренхиматозного орхита и эпидидимита, вызывается наиболее часто вирусами Коксаки В1–5, ЕСНО 6, 9, 11. Энтеровирусы как причина инфекционного орхита занимают второе место после вируса эпидемического паротита. Особенность данного заболевания заключается в том, что на первом этапе развивается клиника другого симптомокомплекса, свойственного ЭВИ (герпангина, менингит и др.), а через 2–3 недели появляются признаки орхита и эпидидимита. Заболевание встречается у детей пубертатного возраста и протекает относительно доброкачественно, но может закончиться и развитием азоспермии.

 

Лабораторная диагностика энтеровирусной инфекции

 

Диагностика включает 4 основных метода [17]:

 

1) серологический;

 

2) иммуногистохимический;

 

3) молекулярно-биологический;

 

4) культуральный.

 

Серологические методы направлены на выявление маркеров ЭВИ в сыворотке крови больных. К ранним маркерам инфекции относятся IgМ и IgА. При выявлении серологических маркеров ЭВИ наиболее репрезентативным является титр IgM, который указывает на недавнюю инфекцию. Поэтому вирусоспецифические IgM являются удобными маркерами «свежего» антигенного стимула, в то время как IgG могут сохраняться и циркулировать в крови переболевшего человека несколько лет или даже всю оставшуюся жизнь. Для индикации IgM применяются методы иммунофлуоресценции и иммунофермент­ного анализа. У больных с острыми симптомами ­заболевания ЭВ-специфические IgM определяются через 1–7 дней от начала инфекции. Через 6 месяцев IgM, как правило, исчезают.

 

К числу наиболее старых, но актуальных серологических методов относится выявление вирусней­трализующих противовирусных антител в реакции нейтрализации, 4-кратное и более нарастание титра считается диагностически значимым.

 

Вирусологические методы исследований направлены на выделение из клинического материала (кровь, фекалии, ликвор) ЭВ на культурах чувствительных клеток.

 

Основной целью иммуногистохимических методов является обнаружение in situ энтеровирусных антигенов. К числу наиболее доступных методов иммуногистохимии относятся иммунофлюоресцентный и иммунопероксидазный анализы.

 

Молекулярно-биологические методы исследования направлены на выявление генетического материала ЭВ.

 

Для диагностики ЭВИ используется полимеразная цепная реакция со стадией обратной транскрипции, которая обладает рядом преимуществ перед ­вышеуказанными методами: высокой специфичностью, чувствительностью и быстротой исполнения.

 

Лечение энтеровирусной инфекции

 

Интерфероны используют для профилактики вирусных инфекций. Эта группа соединений, относящихся к низкомолекулярным гликопротеинам, обладающих в том числе антипикорновирусной активностью, вырабатывается клетками организма при воздействии на них вирусов. Показано повышение уровня эндогенного интерферона в ликворе у детей с ­острыми эпидемическими энтеровирусными менинги­тами, что играет большую роль в освобождении от инфекции. Образуются интерфероны в самом начале вирусной инфекции. Они повышают устойчивость клеток к поражению их вирусами. Для интерферонов характерен широкий противовирусный спектр (специфичностью действия в отношении отдельных вирусов не обладают). Резистентности к интерферонам у вирусов не возникает.

 

В настоящее время в качестве противовирусных средств в основном используются препараты альфа-интерферонов (альфа-2а, альфа-2в), как естественных, так и рекомбинантных. Применяют интерфероны местно и парентерально.

 

Вторая группа препаратов, используемых для лечения ЭВИ, — иммуноглобулины. Показана их клиническая эффективность у больных ЭВИ на фоне иммунодефицитного состояния (врожденного или приобретенного), а также в неонатальной практике у заболевших ЭВИ новорожденных, у которых отсутствовали антитела к ЭВИ (с неонатальным сепсисом при врожденной ЭВИ). Наиболее эффективным оказалось внутривенное введение препарата, широко применяемое в лечении иммунодефицитных больных с острыми и хроническими менингоэнцефалитами, вы­званными ЭВ. Однако опыт применения иммуноглобулинов в данной ситуации недостаточно изучен. Есть данные об успешном излечении менингоэнцефалитов при внутрижелудочковом введении гамма-глобулина.

 

Третья группа — капсидингибирующие препараты. Наиболее эффективным из этой группы является плеконарил. Это наиболее широко используемое этиотропное средство, которое прошло клинические испытания. Плеконарил продемонстрировал широкий спектр противовирусной активности в отношении как риновирусной, так и энтеровирусной инфекции, отличается высокой биодоступностью (70 %) при энтеральном приеме.


Данный препарат может быть использован и используется у новорожденных детей при ЭВИ-менингитах в дозе 5 мг/кг энтерально 3 раза в день в течение 7 дней. Отмечается высокий уровень плеконарила в ЦНС и эпителии носоглотки. При использовании плеконарила в разных возрастных группах не отмечалось побочных эффектов. Широко применяется данный препарат для лечения менингитов, энцефалитов, респираторных инфекций, вызванных ЭВ. При использовании плеконарила в лечении менингитов у детей достоверно отмечено сокращение менингеальных симптомов на 2 дня.

Bibliography

1. Лукашов А.Н. Роль рекомбинации и эволюции энтеровирусов // Микробиология. — 2005. — № 4. — С. 83-89.

2. Амвросьва Т.В., Поклонская Н.В., Богуш З.Ф., Казинец О.Н. и др. Клинико-эпидемиологические особенности и лабораторная диагностика энтеровирусной инфекции в Республике Беларусь // Журн. микробиол. — 2005. — № 2. — С. 20-25.

3. Perez C., Pena M.J., Molina L. En ferm infecc // Microbiol. Clin. — 2003 Aug-Sept. — 21 (7). — 340-5.

4. Tralo G., Casas I., Tenori A. et al. // Epidemiol. infect. — 2000 Jun. — 124 (3). — 497-50.

5. Kehle J., Roth B. еt al. // S. Neurovirol. — 2003 Feb. — 911. — 126-8.

6. Bottner A. // Pediatr. Infect. Dis. J. — 2002 Dec. — 21 (12). — 1126-32.

7. Comel J.J., Antona D., Thourvenot D. // J. Clin. Microbiol. Infect. Dis. — 2003 Mar. — 22, 3. — 191-3.

8. Norder H., Bjerregaard L., Magnius L. // Infection. — 2003 Mar. — 31 (2). — 74-4.

9. Wang J.R., Tsai H.P., Chen P.F. et al. // J. Clin. Virol. — 2000 Fug. — 17 (2). — 91-9.

10. Chan L.G., Parashar U.D., Lye M.S. et al. Deaths of children During an outbreak of hand, foot, and mouth disease in Sarawak, Malasea: clinical and pathological characteristics of the desage // Clin. Infect. Dis. — 2000. — 31. — 678-83.

11. Учайкин Г.Ф., Протосеня И.И. ЭВ менингит у детей Хабаровска.

12. Яшкулов К.Б., Шевырева М.П., Лазикова Г.Ф и др. Вспышка энтеровирусной инфекции с серозным менингитом в Республике Калмыкия и меры по ее локализации и ликвидации // Здоровье населения и среда обитания. — 2003. — № 5. — С. 13-16.

13. Бондарев Л.С., Вяхирева И.В., Сошенко И.И. Эпидемическая вспышка Коксаки В инфекции // Сучаснi инфекцiї. — 1999. — № 2. — С. 69-73.

14. Charbi S., Jaidare H., Manel Ben et al. Epidemiological study of non-polioenteroviruses neurological infections in children in the region of Monastir, Tunisia // J. Diagnostic Microbiol. аnd Infect. Dis. — 2005. — P. 1-5.

15. Viral infections of the heart / Ed. J.E. Banatvala. — London: Ervard Arnold, 1993.

16. Учайкин Г.Ф., Протасеня И.Н., Резник Е.В. и др. // Энтеровирусные менингиты у детей Хабаровска в конце 20-го столетия // Журнал эпид. и инфекц. ­Болезней. — 2003. — № 2. — С. 42-46.

17. Инструкция по лабораторной диагностике энтеровирусных инфекций: Инструкция по применению / Т.В. Амвросьева, Н.В. Поклонская, Е.П.Кишкурно. — Минск: ГУ РНМБ, 2005. — 28 с.  

Инфекция эховирусом 30 и вирусом Коксаки A9 среди новорожденных с сепсисом в Иране

Иран J Microbiol. 2018 Авг; 10 (4): 258–265.

, 1 , 1, * , 1 , 1 , 1 , 1 , 1, 2 , 1 , 2 , 3 4

Абдольнаби Шабани

1 Научно-исследовательский центр инфекционных и тропических болезней, Научно-исследовательский институт здравоохранения, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран

Манучер Макванди

1 Центр исследований в области здравоохранения и инфекционных болезней Институт, Ахваз Джундишапур, Университет медицинских наук, Ахваз, Иран

Алиреза Самарбафзаде

1 Исследовательский центр инфекционных и тропических болезней, Институт медицинских исследований, Ахваз Джундишапурский университет медицинских наук, Ахваз, Иран

Али Теймури

Исследовательский центр инфекционных и тропических болезней, Научно-исследовательский институт здравоохранения, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран

Моджтаба Расти

1 Научно-исследовательский центр инфекционных и тропических болезней, Научно-исследовательский институт здравоохранения, Университет медицинских наук Ахваз Джундишапур, Ахваз, Иран

Чиман Карами

1 Научно-исследовательский центр инфекционных и тропических болезней , Ахваз Джундишапур, Университет медицинских наук, Ахваз, Иран

Настеран Растегарванд

1 Научно-исследовательский центр инфекционных и тропических болезней, Институт медицинских исследований, Ахваз Джундишапурский университет медицинских наук, Ахваз, Иран

2 Департамент инфекционных заболеваний , Больница Абозар, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран

Ройя Никфар

1 Исследовательский центр инфекционных и тропических заболеваний, Институт медицинских исследований, Ахваз Джундишапурский университет медицинских наук, Ахваз, Иран

Ахмад Шамсизаде

Ахмад Шамсизаде

2 Отделение инфекционных болезней, Больница Абозар, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран

Азам Салехи

3 Кафедра паразитологии, Университет медицинских наук Ахваз Джундишапур, Ахваз, Иран

Камбиз Ахмади

Ангали 1

Камбиз Ахмади

Ангали 1 Департамент, Школа здравоохранения, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран

1 Научно-исследовательский центр инфекционных и тропических болезней, Научно-исследовательский институт здравоохранения, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран

2 Департамент инфекционных заболеваний Болезни, Больница Абозар, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран

3 Кафедра паразитологии, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран

4 Кафедра биостатистики, Школа здравоохранения Медицинского университета Ахваза Джундиша Наук, Ахваз, Иран

* Корреспондент г автор: Манучер Макванди, Ph.D, Исследовательский центр инфекционных и тропических болезней, Научно-исследовательский институт здравоохранения, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран. Тел .: +98 61 33738313, Факс: +98 61 33738313, Электронная почта: [email protected]

Поступила в редакцию января 2018 г .; Принята в печать, май 2018 г.

Авторские права © 2018 Иранское общество нейробиологии

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии правильного цитирования оригинальной работы.

Реферат

Предпосылки и цели:

Энтеровирусы человека (ЭВ) являются наиболее частой причиной неонатальных сепсисоподобных заболеваний. Частоты ЭВ, включая серотипы вируса Коксаки А, вируса Коксаки В и эховируса, изучались у детей раннего возраста (младше трех месяцев) с сепсисом. До сих пор роль энтеровирусов среди новорожденных с сепсисом не была определена в Ахвазе, Иран. Таким образом, это исследование было направлено на оценку частоты ЭВ среди госпитализированных младенцев с клиническими признаками и симптомами сепсиса в Ахвазе.

Материалы и методы:

Образцы крови 128 новорожденных (младше 90 дней), в том числе 56 (43,75%) девочек и 72 (56,25%) мальчиков, были взяты у госпитализированных новорожденных с клиническими признаками и симптомами сепсисоподобных симптомов. . Все образцы крови были отрицательными на бактериальный посев. РНК экстрагировали из всех сывороток и тестировали на обнаружение 5’UTR (нетранслируемая область) EV с помощью RT-PCR. Для определения конкретных штаммов EV положительные образцы 5’UTR дополнительно тестировали на определение области VP1 EV с помощью RT-PCR.

Результаты:

В целом 50 из 128 (39,06%) образцов, в том числе 24 (48%) девочек и 26 (52%) мальчиков, были положительными на ЭВ. 21 из 50 (42%) образцов были положительными на область VP1. Случайным образом были отобраны и секвенированы 8 положительных VP1. Анализ данных секвенирования показал, что 7/21 (33,33%) образца были положительными на Echovirus 30 и 1/21 (4,76%) образца были положительными на CVA9.

Заключение:

Результаты этого исследования указывают на высокую распространенность 39,06% ЭВ среди новорожденных с сепсисом.У новорожденных с вирусным сепсисом наблюдалась высокая распространенность 33,3% эховирусов 30 и низкая частота 4,76% инфицирования вирусом Коксаки A9. Эта вспышка, вероятно, является одной из первых вспышек энтеровируса, зарегистрированных в Ахвазе, Иран. Результаты этого опроса помогут свести к минимуму ненужное использование противомикробных препаратов и уменьшить количество ненужных госпитализаций.

Ключевые слова: Сепсис, энтеровирусы, эховирус, вирус Коксаки

ВВЕДЕНИЕ

Симптомы сепсиса неспецифичны и включают вздутие живота, апноэ, лихорадку, раздражительность и усталость, судороги, сыпь и проблемы с кормлением.Возбудители неонатального сепсиса могут быть вирусными или бактериальными (1–7). Среди вирусов энтеровирусы человека являются важными агентами, вызывающими сепсис у новорожденных во всем мире. Род человеческих энтеровирусов (EV) представляет собой единственную положительную РНК и относится к пикорнавиридам (1). На основании их антигенных и патогенных свойств у людей и лабораторных животных, EV классифицируются на полиовирусы (PV, три серотипа), вирусы Коксаки (CAV, двадцать три). серотипы), вирусы Коксаки B (CBV, шесть серотипов) и эховирусы (E, двадцать восемь серотипов) и энтеровирусы 68–71 (2).Однако это биологическое разделение было заменено молекулярной классификацией, основанной на секвенировании VP1 (3). Анализ последовательности человеческих энтеровирусов был, кроме того, сгруппирован по четырем видам (от EV-A до D), среди которых шесть различных видов A (CAV2, CAV4, CAV6, CAV10, CAV16 и EV71) и четыре вида серотипов B (E6, E9, E30 и CAV9) были обнаружены у маленьких детей с сепсисоподобным заболеванием в Эдинбурге и Соединенных Штатах Америки (4–6). Внутри EV вида B (все эховирусы, CBV1-6 и CAV9) были обнаружены у новорожденных с сепсисоподобным заболеванием (1–4).Энтеровирусы человека подразделяются на более чем 100 серотипов, среди которых все эховирусы, вирус Коксаки A9 (CVA9), энтеровирус 69 и энтеровирус 71 являются хорошо известными возбудителями менингита (8, 9). Человеческий энтеровирус связан с широким спектром заболеваний, от фебрильных до мультисистемных, таких как асептический менингит, паралич, миокардит и неонатальный сепсис (10). ЭВ могут передаваться как горизонтально (фекально-орально / орально-орально), так и вертикально (пренатальная инфекция). Энтеровирусы человека (EV) — частая причина неонатального сепсиса, особенно на стыке лета и осени.Инфекция возникает у детей раннего возраста, особенно летом и осенью (11). Количество вирусных патогенов у младенцев с лихорадкой (от 1 до 90 дней) в 3 раза больше, чем у бактерий (12). Эпидемиология вирусного сепсиса среди новорожденных была описана в Кувейте (3), Шотландии (4), Англии (5), США (6), Палестине (8) и Нидерландах (11).

Лабораторное обнаружение ЭВ обычно проводится с помощью ПЦР с обратной транскрипцией (ОТ-ПЦР) или ПЦР в реальном времени, которые быстрее и более чувствительны, чем культура вирусных клеток.5’-некодирующая область (NCR) является наиболее консервативной областью среди ЭВ и является мишенью для многих процедур диагностического скрининга (13). Однако последовательности из этой области предоставляют мало информации или не предоставляют никакой информации о серотипе инфицирующего вируса, и для идентификации EV и вируса Parecho человека (HPeV) требуется секвенирование области структурного гена, такой как VP1 (4, 13). Этот метод используется для выявления энтеровируса у больных сепсисом и менингитом (13, 14). VP1 является одним из белков капсида, который содержит сайт нейтрализации антигена, специфичный для серотипа.Кроме того, последовательность VP1 включает гипервариабельную область, высокую скорость мутаций и рекомбинации, поэтому анализ этой области используется для определения и филогенетической классификации серотипов энтеровирусов (15, 16). Поскольку знания о роли энтеровирусов у новорожденных с сепсисом в нашем регионе ограничены, данное исследование было направлено на определение этиологических агентов вирусного сепсиса и их молекулярную характеристику у новорожденных, госпитализированных в городе Ахваз, город Ахваз является столицей Провинция Хозестан и расположена в юго-западном регионе Ирана.

МАТЕРИАЛЫ И МЕТОДЫ

Первоначально сыворотки были собраны у 140 новорожденных, которые были госпитализированы в больницу Абозар, город Ахваз, Иран, в период с сентября 2013 г. по октябрь 2014 г. Пациенты в возрасте> 3 месяцев, образец пациента положительный на бактериальный инфекции были исключены. Культура крови была сделана для всех образцов. Пробы Twelves были положительными на бактериальные патогены и исключены из исследования. Критериями включения были пациенты в возрасте <90 дней, лихорадка> 38 ° C, раздражительность и тахикардия.Всего для этого исследования было отобрано 128 новорожденных, в том числе 56 (43,75%) женщин и 72 (56,25%) мужчин. Демография пациентов, включая пол, возраст, клинические симптомы (лихорадка, тахикардия), лабораторные параметры, такие как количество лейкоцитов, тромбоцитов, CRP (C — реактивный белок), регистрировалась для каждого человека.

Экстракция РНК и ОТ-ПЦР.

РНК

экстрагировали из 128 образцов сыворотки с использованием набора для выделения высокочистой РНК (Roche / Германия) в соответствии с протоколом производителя. КДНК была приготовлена ​​в соответствии с инструкциями поставщика (Thermo Scientific / США).Выявление генома энтеровируса проводили с помощью полувложенной ПЦР. Вакцину Сэбина использовали в качестве положительного контроля. Реакционная смесь для ПЦР состояла из 2,5 мкл буфера для ПЦР, 0,5 мкл dNTP, 0,75 мкл каждого праймера EV-F1 и EV-R (), 0,75 мкл MgCl 2 , 0,12 мкл Taq, 2,5 мкл матрицы и D / W up. до 25 мкл. Реакционную смесь подвергали термоциклеру (TC-512, Techne, UK) в течение 35 циклов амплификации (94 ° C в течение 45 с, 54 ° C в течение 45 с, 72 ° C в течение 45 с и 72 ° C в течение 10 мин. ). Затем 1 мкл продукта использовали в качестве шаблона для второго раунда, который состоял из 2.5 мкл буфера для ПЦР, 0,5 мкл dNTP, 0,75 мкл каждого праймера EV-F2 и EV-R, 0,75 мкл MgCl 2 , 1 мкл матрицы, 0,12 Taq и 18,62 мкл D / W подвергали 35 циклам амплификации (94 ° C в течение 30 секунд, 58 ° C в течение 30 секунд, 72 ° C в течение 30 секунд и 72 ° C в течение 5 минут). Конечный продукт из 155 пар оснований, подвергнутый электрофорезу в 2% геле, показал положительный результат (17).

Таблица 1.

Универсальные праймеры полугнездовой ПЦР

F2): TCCTCCGGCCCCTGAATGCG
Праймер Область генома Последовательность Размер продукта
Первый шаг 5 ′ UTR EV-1 (F1): CAAGCACTTCTGTTTCCCCGG 440 п.н. (17)
EV-R: ATTGTCACCATAAGCAGCCA
155 п. R): GCICCIGAYTGITGICCRAA

Обнаружение области VP1 энтеровируса проводили для образцов, положительных на 5UTR.Реакционная смесь для ПЦР включала 2,5 мкл 10X буфера для ПЦР, 0,5 мкл dNTP, 0,5 мкл каждого праймера VP1-F и VP1-R (), 0,12 мкл Taq, 2,5 мкл матрицы, 0,5 мкл dNTP и воду до 25 мкл подвергали воздействию термоциклер на 35 циклов амплификации (94 ° C в течение 45 секунд, 54 ° C в течение 45 секунд, 72 ° C в течение 45 секунд и 72 ° C в течение 10 минут). Конечный продукт 1000 пар оснований, подвергнутый электрофорезу на 2% геле, показал положительный результат теста.

Последовательность.

Для определения серотипов EV случайным образом были секвенированы 8 положительных образцов области VP1.Последовательности были обработаны с использованием доступных баз данных. Филогенное дерево было построено с помощью метода объединения соседей с использованием частичных нуклеотидных последовательностей области VP1 положительных образцов EV. Контрольные последовательности были получены из GenBank с использованием их номеров доступа.

Этический статус.

Этот проект с регистрационным номером ajums.REC.1392.338 был одобрен этическим комитетом Ахваза Джундишапурского университета медицинских наук в Ахвазе, Иран. Согласие было получено от каждого молодого родителя новорожденного.

Статистический анализ.

Статистический анализ проводился для переменных лейкоцитов, нейтрофилов, тромбоцитов и С-реактивного белка. Переменные были записаны как средние значения, стандартное отклонение. Для анализа ассоциации EV по полу, возрастной группе и сезону были выполнены с помощью хи-квадрат или точного критерия Фишера. Данные были проанализированы с помощью SPSS Statistics ver. 22. P Значения <0,05 считались статистически значимыми.

РЕЗУЛЬТАТЫ

Все 128 проб были отрицательными на бактериальный патоген.Геном энтеровируса был обнаружен в 50 (39,06%) образцах, включая 24 (48%) женщин и 26 (52%) мужчин, методом ПЦР. Из 50 образцов 21 образец показал положительный результат на область VP1. Анализ секвенирования 8 образцов на VP1 показал, что 7 образцов были Echovirus 30 и один образец был вирусом Коксаки A9 (). показывает распределение энтеровируса по полу, возрасту, разным сезонам, клиническим симптомам и лабораторным параметрам. и показать распределение энтеровируса по разным возрастным группам и временам года. Филогенетическое дерево с соединением соседей было построено с помощью программного обеспечения MEGA версии 6.Нуклеотидные последовательности в регионах VP1 штаммов вируса Echo 30, выделенных от пациентов с сепсисом в Ахваз-Иран, с регистрационным номером (KX771182-94), помечены черными сплошными квадратами (). Соседнее филогенетическое дерево нуклеотидных последовательностей в регионах VP1 штамма вируса Коксаки А9, выделенного от пациента с сепсисом в Ахвазе, Иран, с инвентарным номером {«type»: «entrez-нуклеотид», «attrs»: {«text «:» KX771195 «,» term_id «:» 1227950078 «,» term_text «:» KX771195 «}} KX771195 помечено черным сплошным кружком ().

VP1 ПЦР. N: Линия 1: лестница ДНК 100 п.н., Линия 2 N: Отрицательный контроль; Строка 4, P: положительный контроль; № 3, 6–14: Неизвестные образцы

Таблица 2.

Профиль новорожденных с сепсисом, ассоциированным с ЭВ.

Клинические симптомы 38–39.5 мм 3
Характеристика EV положительный % Значение P
Кол-во пациентов (n = 39194 9019 128)06%)
Пол
Женский 24/56 (18,75%) 0,438
Мужской 26/72
Возраст (дни)
1–7 15/34 (44,11%)
8–30 21/55 (38,1819%)
31–90 14/39 (35.89%)
Сезон
Зима 14/25 (56%) 0,035
Весна 15/37
Лето 31/11 (35,48%)
Осень 10/35 (28,57%)
128 (100%)
Тахикардия 39/128 (30%)
Лабораторный параметр
NA 9,790 — 28000
Абсолютное количество нейтрофилов (/ мм 3 ) NA 4,362 — 6,955
9000 мм тромбоцитов 9 ) NA 313–450
CRP C-реактивный белок (мг / л) NA 3.5 ± 1,7

A: Соседнее филогенетическое дерево было построено с помощью программного обеспечения MEGA версии 6 нуклеотидных последовательностей в регионах VP1 штаммов Echo 30, выделенных от пациентов с сепсисом в Ахвазе, Иран с регистрационным номером. (KX771182-94), полученный из банка генов и сравненный с другим Echo 30, изолированным из других регионов мира. Изоляты Ирана (Ахваз) помечены черными сплошными квадратами, а Echo 30 ({«type»: «entrez-nucleotide», «attrs»: {«text»: «KX351155», «term_id»: «1149325638», «term_text»: «KX351155»}} KX351155) Штамм-прототип Иран (Ахваз) обозначен черным сплошным кружком.Их сравнивали с другими изолятами штаммов Echo 30 из других регионов мира. Числа в ветках воспроизводятся после 1000 загрузок. Шкала шкалы = 2%. B: Соседнее филогенетическое дерево нуклеотидных последовательностей в регионах VP1 штамма вируса Коксаки А9, выделенного от пациента с сепсисом в Ахвазе, Иран, с инвентарным номером {«type»: «entrez-нуклеотид», «attrs»: { «text»: «KX771195», «term_id»: «1227950078», «term_text»: «KX771195»}} KX771195, отмеченный черным сплошным кружком.Его сравнивали с другими изолятами вируса Коксаки A9 из других регионов мира. Числа в ветвях воспроизводятся после 1000 бутстрепов. Масштабная шкала = 0,1

Распределение энтеровируса среди разных возрастных групп.

Частота энтеровируса в разные сезоны. Номера доступа GenBank для последовательностей VP1 были следующими: {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KX771188», «term_id»: «1227950064», «term_text»: «KX771188» }} KX771188, {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KX771189», «term_id»: «1227950066», «term_text»: «KX771189»}} KX771189, {«type «:» entrez-нуклеотид «,» attrs «: {» text «:» KX771190 «,» term_id «:» 1227950068 «,» term_text «:» KX771190 «}} KX771190, {» type «:» entrez-nucleotide » , «attrs»: {«text»: «KX771191», «term_id»: «1227950070», «term_text»: «KX771191»}} KX771191, {«type»: «entrez-нуклеотид», «attrs»: {» text «:» KX771192 «,» term_id «:» 1227950072 «,» term_text «:» KX771192 «}} KX771192, {» type «:» entrez-нуклеотид «,» attrs «: {» text «:» KX771193 «, «term_id»: «1227950074», «term_text»: «KX771193»}} KX771193 и {«type»: «entrez-nucleotide», «attrs»: {«text»: «KX771194», «term_id»: «1227950076» , «term_text»: «KX771194»}} KX771194 и {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KX771195», «term_id»: «1227950078», «term_text»: «KX771195 «}} KX771195.

ОБСУЖДЕНИЕ

Сепсис у новорожденных и младенцев грудного возраста является важным клиническим явлением, которое приводит к большому количеству госпитализаций ежегодно. По оценкам, около 0,6–3% младенцев повторно госпитализируются с подозрением на сепсис в первый месяц жизни, и большинство пациентов инфицированы энтеровирусом (19).

Эта вспышка, вероятно, является одной из первых крупных вспышек энтеровирусов, зарегистрированных в городе Ахваз, Иран. Результаты этого опроса помогут свести к минимуму ненужное использование противомикробных препаратов и уменьшить количество ненужных госпитализаций.Синдромный надзор с использованием данных отделения неотложной помощи оказался полезным и правильным способом мониторинга госпитализаций отделений неотложной помощи в связи со вспышкой энтеровирусов.

В нашем исследовании описана частота инфекций ЭВ в сыворотке крови новорожденных с подозрением на сепсис в Ахвазе, Иран, с сентября 2013 г. по октябрь 2014 г. В настоящем исследовании геном энтеровируса был обнаружен в 50/128 (39,06%) образцах, включая 24 (18,75%) женщин и 26 (20,31%) мужчин ( р, = 438).Частота обнаружения ЭМ у новорожденных варьировала в разных регионах мира.

Harvala et al. в Эдинбурге исследовали этот феномен в течение восьми лет и сообщили, что 58% новорожденных с сепсисом были положительными на ЭВ (4). Maguire et al. обнаружили энтеровирусы у 29% новорожденных с сепсисом в Англии и Уэльсе (5). Хецуриани и др. обнаружили ЭВ у 44% новорожденных с сепсисом в США, что согласуется с нашими выводами (20).

Verboon-Maciolek et al.диагностировали ЭМ у 57% новорожденных с синдромом сепсиса в Нидерландах, что показывает более высокий процент, чем наш результат (11). Джордан из Испании сообщил, что 10/72 (13,88%) новорожденных с лихорадкой были положительными на ЭМ, что указывает на более низкий процент, чем наш результат (21). В нашем исследовании 7/8 (87,5%) новорожденных с сепсисом оказались положительными на вирус Echo 30, в то время как 1/8 (12,5%) случаев были положительными на вирус Коксаки A9. И Echo virus 30, и вирус Коксаки A9 принадлежат к видам энтеровирусов B и были связаны с пациентами с сепсисом.О роли видов энтеровирусов B у новорожденных с сепсисом сообщали другие исследователи (4–6). Частота вируса Echo 30 оказалась доминирующей среди новорожденных в нашем регионе. Harvala et al. описали E9, CAV9, CBV5, E6, E11, E30, CAV2, CAV4, CAV6, CAV10, CAV16 и EV71 как связанные с сепсисоподобным заболеванием, среди которых E6, E9, E30 и CAV9 являются наиболее распространенными выделенными серотипами. из клинических образцов в Великобритании и США (4, 19, 20). Джи-Хён Со и др.описали обнаружение энтеровируса среди детей раннего возраста с заболеванием, похожим на сепсис, на уровне 7,5% в Чинджу, Корея (22). Следует учитывать, что причина расхождения в распространенности между различными другими исследованиями, и это может быть связано с чувствительностью используемого метода или типов образцов.

В нашем исследовании ЭВ наблюдались у новорожденных с сепсисом в любое время года: осенью (28,57%), зимой (56%), весной (40,54%) и летом (35,48%). Максимальное обнаружение EV наблюдалось в зимний сезон, а самое низкое — осенью (28.57%) ( р = 0,035). Наши результаты показывают, что инфекция HEV происходит в течение всего года, а не только весной и летом, тогда как Harvala et al. 2011 (Эдинбург, Великобритания) и Ju-Young Chung et al. 2015 г. (Чинджу, Южная Корея) описал пик обнаружения электромобилей весной (22, 23). Han et al. 2013 (Сеул, Корея) и Walters et al. (Чикаго, США) описали, что пиковый сезон для обнаружения электромобилей приходился на лето (24, 25).

В Иране частота энтеровируса у новорожденных, согласно сообщениям, в городе Мешхед составляла 37% (26), а в Тегеране — 32% (27).Rasti et al описали, что обнаружение ЭМ у детей в возрасте до одного года с асептическим менингитом составляет 55,8% в Ахвазе (28).

В настоящем исследовании 78/128 (60,93%) пациентов с сепсис-подобным синдромом показали отрицательный результат на ЭВ. Было признано, что пареховирусы являются важными агентами сепсиса у новорожденных (29, 30, 31). Среди них более доминирующей является роль пареховируса 3 в связи с сепсисоподобным синдромом у новорожденных (29, 30). В настоящем исследовании сыворотка пациентов использовалась для обнаружения ЭВ.Сыворотка не хуже, чем CSF, в качестве диагностического инструмента для системной энтеровирусной инфекции, хотя для подтверждения этого наблюдения следует проанализировать больше пациентов. Быстрая диагностика энтеровирусной инфекции у детей грудного возраста важна для предотвращения и сокращения использования антибиотиков широкого спектра действия и, возможно, для указания того, что в тяжелых случаях следует начинать противовирусное лечение. Было продемонстрировано, что быстрая диагностика энтеровирусной болезни значительно сокращает пребывание в больнице и затраты (19).

ЗАКЛЮЧЕНИЕ

Результаты этого опроса показывают, что частота ЭВ среди пациентов с сепсисом составляла 39.06%. Среди положительных случаев ЭВ у молодых новорожденных с вирусным сепсисом наблюдалась высокая частота 14% эховирусов 30 и низкая распространенность 2% вируса Коксаки А9. 78 (60,93%) пациентов показали отрицательный результат на ЭВ. Необходимо изучить роль пареховируса. Синдромный эпиднадзор — полезный косвенный индикатор, который следует учитывать для будущего выявления и надзора за сезонными вспышками энтеровирусных инфекций. Эта вспышка, вероятно, является одной из первых вспышек энтеровируса, зарегистрированных в Ахвазе, Иран.Результаты этого опроса помогут свести к минимуму ненужное использование противомикробных препаратов и уменьшить количество ненужных госпитализаций.

БЛАГОДАРНОСТИ

Это исследование было проведено как исследовательский проект с регистрационным номером OG-92154, выполненный Абдольнаби Шабани (магистр наук, вирусология). Этот проект получил финансовую поддержку Исследовательского центра инфекционных и тропических заболеваний, Научно-исследовательского института здравоохранения, Университета медицинских наук Ахваза Джундишапура, Ахваз, Иран. Авторы высоко оценивают все старания сотрудников лаборатории Абузарской детской больницы, в том числе предоставление образцов для исследований.Этот проект поддержан Исследовательским центром инфекционных и тропических болезней.

СПИСОК ЛИТЕРАТУРЫ

1. Ноулз Н.Дж., Хови Т., Хюпия Т., Кинг AMQ., Линдберг А.М., Палланш М.А., Пальменберг А.С., Скерн Т., Стэнвей Г., Ямашита Т., Целл Р. Picornaviridae. В: King AMQ., Adams MJ., Carstens EB., Lefkowitz EJ., Редакторы. Таксономия вирусов: классификация и номенклатура вирусов: девятый доклад международного комитета по таксономии вирусов. Эльзевир; Сан-Диего: 2011. стр. 855–880. [Google Scholar] 2.Ноулз Нью-Джерси, Хови Т., Хюипи Т., Кинг А.М., Линдберг А.М., Палланш М.А. и др. Picornaviridae. В: King AM, Adams MJ, Carstens EB, Lefkowitz EJ, редакторы. Таксономия вирусов: классификация и номенклатура вирусов. Девятый доклад Международного комитета по таксономии вирусов. Сан-Диего: Эльзевьер; 2012. с. 855–80. [Google Scholar] 3. Ахмад С., Далвай А., Аль-Накиб В. Частота обнаружения энтеровируса в образцах крови новорожденных, госпитализированных с сепсисоподобным заболеванием в Кувейте. J Med Virol 2013; 85: 1280–1285.[PubMed] [Google Scholar] 4. Харвала Х., Калверт Дж., Ван Нгуен Д., Класпер Л., Гэдсби Н., Молино П. и др. Сравнение диагностических клинических образцов и образцов окружающей среды для эпиднадзора за энтеровирусами и пареховирусами в Шотландии, 2010–2012 гг. Euro Surveill 2014; 19 (15): 20772. [PubMed] [Google Scholar] 5. Магуайр ХК, Аткинсон П., Шарланд М., Бендиг Дж. Энтеровирусные инфекции в Англии и Уэльсе: данные лабораторного наблюдения: с 1975 по 1994 год. Общественное здравоохранение. 1999; 2: 122–125. [PubMed] [Google Scholar] 6.Шарп Дж., Харрисон С.Дж., Пакетт К., Селвараджу С.Б., Пенаранда С., Никс В.А. и др. Характеристики младенцев, у которых пареховирус человека, энтеровирус, или ни то, ни другое не было обнаружено в спинномозговой жидкости во время оценки сепсиса. Педиатр Infect Dis J 2013; 32: 213–216. [Бесплатная статья PMC] [PubMed] [Google Scholar] 7. Greenhow TL, Hung YY, Herz AM. Изменение эпидемиологии бактериемии у младенцев в возрасте от 1 недели до 3 месяцев. Педиатрия 2012; 129 (3): e590–596. [PubMed] [Google Scholar] 8. Думаиди К., Аль-Джавабрех А.Молекулярное обнаружение и генотипирование энтеровирусов в образцах спинномозговой жидкости пациентов с подозрением на сепсис-подобное заболевание и / или асептический менингит с 2012 по 2015 годы на Западном берегу, Палестина. PLoS One 2017; 12 (2): e0172357. [Бесплатная статья PMC] [PubMed] [Google Scholar] 9. Раканиелло Винсент Р. Picornaviridae: вирусы и их размножение. В: Книп Д.М., Хоули П.М., редакторы. Области вирусологии. 6 изд., Т. 1 Филадельфия: Липпинкотт Уильямс и Уилкинс; 2013. с. 610e64. [Google Scholar] 10. Капушинский Б., Сомор К.Н., Фаркаш А., Такач М., Беренси Г.Выявление неполиомиелитных энтеровирусов в Венгрии в 2000–2008 гг. И молекулярная эпидемиология энтеровируса 71, вируса Коксаки A16 и эховируса 30. Гены вирусов 2010; 40: 163–73. [PubMed] [Google Scholar] 11. Verboon-Maciolek M, Nijhuis M, Van Loon A, Van Maarssenveen N, Van Wieringen H, Pekelharing-Berghuis M и др. Диагностика энтеровирусной инфекции в первые 2 месяца жизни методом полимеразной цепной реакции в режиме реального времени. Clin Infect Dis 2003; 37: 1–6. [PubMed] [Google Scholar] 12. Byington CL, Enriquez FR, Hoff C, Tuohy R, Taggart EW, Hillyard DR, et al.Серьезные бактериальные инфекции у младенцев с лихорадкой от 1 до 90 дней с вирусными инфекциями и без них. Педиатрия 2004. 113: 1662–1666. [PubMed] [Google Scholar] 13. Эспозито С., Рахамат-Лангендоен Дж., Асколезе Б., Сенаторе Л., Кастеллацци Л., Нистерс Х. Г.. Детские пареховирусные инфекции. J Clin Virol 2014; 60: 84–89. [PubMed] [Google Scholar] 14. Wolthers KC, Benschop KS, Schinkel J, Molenkamp R, Bergevoet RM, Spijkerman IJ, et al. Человеческие пареховирусы как важная вирусная причина сепсисоподобных заболеваний и менингита у детей раннего возраста.Clin Infect Dis 2008. 47: 358–363. [PubMed] [Google Scholar] 15. Пэк К., Пак К., Юнг Э, Чунг Э, Пак Дж., Чой Х и др. Молекулярная и эпидемиологическая характеристика энтеровирусов, выделенных в Чуннам, Корея, с 2005 по 2006 год. J Microbiol Biotechnol 2009; 19: 1055–1064. [PubMed] [Google Scholar] 16. Mirand A, Henquell C, Archimbaud C, Chambon M, Charbonne F, Peigue-Lafeuille H и др. Перспективная идентификация энтеровирусов, вызывающих менингит, в 2006 г. путем прямого генотипирования спинномозговой жидкости.J Clin Microbiol 2008. 46: 87–96. [Бесплатная статья PMC] [PubMed] [Google Scholar] 17. Мохамадпур Т., Набавиния М., Голуби А., Алави М., Мешкат З. Энтеровирусы при остром инфаркте миокарда. Иран J Общественное здравоохранение 2012; 41: 71–74. [Бесплатная статья PMC] [PubMed] [Google Scholar] 18. Тан Дж., Ёсида Х., Дин З., Тао З., Чжан Дж., Тиан Б. и др. Молекулярная эпидемиология и рекомбинация энтеровирусов человека в результате эпиднадзора за ОВП в Юньнани, Китай, с 2006 по 2010 год. Sci Rep 2014; 4: 6058. [Бесплатная статья PMC] [PubMed] [Google Scholar] 19.Verboon-Maciolek MA, Nijhuis M, van Loon AM, van Maarssenveen N, van Wieringen H, Pekelharing-Berghuis MA, et al. Диагностика энтеровирусной инфекции в первые 2 месяца жизни методом полимеразной цепной реакции в режиме реального времени. Clin Infect Dis 2003; 37: 1–6. [PubMed] [Google Scholar] 20. Хецуриани Н., Ламонте-Фаулкес А., Оберсте С., Палланш М.А. Эпиднадзор за энтеровирусами — США, 1970–2005 гг. MMWR Surveill Summ 2006; 55: 1–20. [PubMed] [Google Scholar] 21. Йордан I, Эстева Ц., Эстебан Э., Ногера А., Гарсия Х. Дж., Муньос-Альмагро К.Тяжелая энтеровирусная болезнь у новорожденных с лихорадкой. Энферм Инфекк Микробиол Клин 2009. 27: 399–402. [PubMed] [Google Scholar] 22. Со Джи-Хён, Ём Чжон Сук, Ён Хи-Шан, Хан Тэ-Хи, Чунг Джу Ён. Распространенность пареховируса человека и энтеровируса в образцах спинномозговой жидкости у детей в Чинджу, Корея. Корейский J Pediatr 2015; 58: 102–107. [Бесплатная статья PMC] [PubMed] [Google Scholar] 23. Harvala H, McLeish N, Kondracka J, McIntyre CL, McWilliam, Leitch EC и др. Сравнение частот обнаружения пареховируса человека и энтеровируса в образцах спинномозговой жидкости, собранных за 5-летний период в Эдинбурге: HPeV типа 3 идентифицирован как наиболее распространенный тип пикорнавирусов.J Med Virol 2011; 83: 889–896. [PubMed] [Google Scholar] 24. Хан TH, Chung JY, You SJ, Youn JL, Shim GH. Инфекция пареховируса человека-3 у детей, Южная Корея. J Clin Virol 2013; 58: 194–199. [PubMed] [Google Scholar] 25. Уолтерс Б., Пенаранда С., Никс В.А., Оберсте М.С., Тодд К.М., Кац Б.З. и др. Обнаружение пареховируса человека (HPeV) -3 в образцах спинномозговой жидкости от педиатрических пациентов в районе Чикаго. J Clin Virol 2011; 52: 187–191. [PubMed] [Google Scholar] 26. Шахруди М.Дж., Газвини К., Садеги Р., Сасан М.С.Энтеровирусный менингит у новорожденных и детей в Мешхеде, Иран. Джундишапур Дж Микробиол 2016; 9 (5): e19955. [Бесплатная статья PMC] [PubMed] [Google Scholar] 27. Рахими П., Махдиан Насер Х., Сохраби А. Связь неполиомиелитных энтеровирусов с асептическим менингитом у детей в Иране. JoMMID 2014; 2: 56–60. [Google Scholar] 28. Моджтаба Р., АлиРеза С.З., Манучер М., Ахмад С.З. Относительная частота энтеровирусов у детей с асептическим менингитом, поступивших в больницу Абузар в Ахвазе. Джундишапур Дж Микробиол 2012; 5: 456–459.[Google Scholar] 29. Тан Дж. У., Холмс К. В., Эльсануси Ф. А., Патель А., Адам Ф., Спейт Р. и др. Кластер инфекций пареховируса человека как преобладающей причины сепсиса у новорожденных и младенцев, Лестер, Соединенное Королевство, 8 мая — 2 августа 2016 г. Euro Surveill 2016; 21 (34): 30326. [Бесплатная статья PMC] [PubMed] [Google Scholar] 30. Braccio S, Kapetanstrataki M, Sharland M, Ladhani SN. Поступления в реанимацию для детей с энтеровирусными и пареховирусными инфекциями человека в Соединенном Королевстве и Ирландии, 2010–2014 гг.Педиатр Infect Dis J 2017; 36: 339–342. [PubMed] [Google Scholar] 31. Колехмайнен Пекка, Сипонен Ану, Смура Теему, Каллио-Коккок Ханнимари, Вапалахти Олли, Яэскеляйнен Анне и др. Межтиповая рекомбинация пареховируса человека 4, выделенного от младенцев с сепсисоподобным заболеванием. J Clin Virol 2017; 88: 1–7. [PubMed] [Google Scholar]

Инфекция эховирусом 30 и вирусом Коксаки A9 среди новорожденных с сепсисом в Иране

Iran J Microbiol. 2018 Авг; 10 (4): 258–265.

, 1 , 1, * , 1 , 1 , 1 , 1 , 1, 2 , 1 , 2 , 3 4

Абдольнаби Шабани

1 Научно-исследовательский центр инфекционных и тропических болезней, Научно-исследовательский институт здравоохранения, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран

Манучер Макванди

1 Центр исследований в области здравоохранения и инфекционных болезней Институт, Ахваз Джундишапур, Университет медицинских наук, Ахваз, Иран

Алиреза Самарбафзаде

1 Исследовательский центр инфекционных и тропических болезней, Институт медицинских исследований, Ахваз Джундишапурский университет медицинских наук, Ахваз, Иран

Али Теймури

Исследовательский центр инфекционных и тропических болезней, Научно-исследовательский институт здравоохранения, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран

Моджтаба Расти

1 Научно-исследовательский центр инфекционных и тропических болезней, Научно-исследовательский институт здравоохранения, Университет медицинских наук Ахваз Джундишапур, Ахваз, Иран

Чиман Карами

1 Научно-исследовательский центр инфекционных и тропических болезней , Ахваз Джундишапур, Университет медицинских наук, Ахваз, Иран

Настеран Растегарванд

1 Научно-исследовательский центр инфекционных и тропических болезней, Институт медицинских исследований, Ахваз Джундишапурский университет медицинских наук, Ахваз, Иран

2 Департамент инфекционных заболеваний , Больница Абозар, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран

Ройя Никфар

1 Исследовательский центр инфекционных и тропических заболеваний, Институт медицинских исследований, Ахваз Джундишапурский университет медицинских наук, Ахваз, Иран

Ахмад Шамсизаде

Ахмад Шамсизаде

2 Отделение инфекционных болезней, Больница Абозар, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран

Азам Салехи

3 Кафедра паразитологии, Университет медицинских наук Ахваз Джундишапур, Ахваз, Иран

Камбиз Ахмади

Ангали 1

Камбиз Ахмади

Ангали 1 Департамент, Школа здравоохранения, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран

1 Научно-исследовательский центр инфекционных и тропических болезней, Научно-исследовательский институт здравоохранения, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран

2 Департамент инфекционных заболеваний Болезни, Больница Абозар, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран

3 Кафедра паразитологии, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран

4 Кафедра биостатистики, Школа здравоохранения Медицинского университета Ахваза Джундиша Наук, Ахваз, Иран

* Корреспондент г автор: Манучер Макванди, Ph.D, Исследовательский центр инфекционных и тропических болезней, Научно-исследовательский институт здравоохранения, Университет медицинских наук Ахваза Джундишапура, Ахваз, Иран. Тел .: +98 61 33738313, Факс: +98 61 33738313, Электронная почта: [email protected]

Поступила в редакцию января 2018 г .; Принята в печать, май 2018 г.

Авторские права © 2018 Иранское общество нейробиологии

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии правильного цитирования оригинальной работы.

Реферат

Предпосылки и цели:

Энтеровирусы человека (ЭВ) являются наиболее частой причиной неонатальных сепсисоподобных заболеваний. Частоты ЭВ, включая серотипы вируса Коксаки А, вируса Коксаки В и эховируса, изучались у детей раннего возраста (младше трех месяцев) с сепсисом. До сих пор роль энтеровирусов среди новорожденных с сепсисом не была определена в Ахвазе, Иран. Таким образом, это исследование было направлено на оценку частоты ЭВ среди госпитализированных младенцев с клиническими признаками и симптомами сепсиса в Ахвазе.

Материалы и методы:

Образцы крови 128 новорожденных (младше 90 дней), в том числе 56 (43,75%) девочек и 72 (56,25%) мальчиков, были взяты у госпитализированных новорожденных с клиническими признаками и симптомами сепсисоподобных симптомов. . Все образцы крови были отрицательными на бактериальный посев. РНК экстрагировали из всех сывороток и тестировали на обнаружение 5’UTR (нетранслируемая область) EV с помощью RT-PCR. Для определения конкретных штаммов EV положительные образцы 5’UTR дополнительно тестировали на определение области VP1 EV с помощью RT-PCR.

Результаты:

В целом 50 из 128 (39,06%) образцов, в том числе 24 (48%) девочек и 26 (52%) мальчиков, были положительными на ЭВ. 21 из 50 (42%) образцов были положительными на область VP1. Случайным образом были отобраны и секвенированы 8 положительных VP1. Анализ данных секвенирования показал, что 7/21 (33,33%) образца были положительными на Echovirus 30 и 1/21 (4,76%) образца были положительными на CVA9.

Заключение:

Результаты этого исследования указывают на высокую распространенность 39,06% ЭВ среди новорожденных с сепсисом.У новорожденных с вирусным сепсисом наблюдалась высокая распространенность 33,3% эховирусов 30 и низкая частота 4,76% инфицирования вирусом Коксаки A9. Эта вспышка, вероятно, является одной из первых вспышек энтеровируса, зарегистрированных в Ахвазе, Иран. Результаты этого опроса помогут свести к минимуму ненужное использование противомикробных препаратов и уменьшить количество ненужных госпитализаций.

Ключевые слова: Сепсис, энтеровирусы, эховирус, вирус Коксаки

ВВЕДЕНИЕ

Симптомы сепсиса неспецифичны и включают вздутие живота, апноэ, лихорадку, раздражительность и усталость, судороги, сыпь и проблемы с кормлением.Возбудители неонатального сепсиса могут быть вирусными или бактериальными (1–7). Среди вирусов энтеровирусы человека являются важными агентами, вызывающими сепсис у новорожденных во всем мире. Род человеческих энтеровирусов (EV) представляет собой единственную положительную РНК и относится к пикорнавиридам (1). На основании их антигенных и патогенных свойств у людей и лабораторных животных, EV классифицируются на полиовирусы (PV, три серотипа), вирусы Коксаки (CAV, двадцать три). серотипы), вирусы Коксаки B (CBV, шесть серотипов) и эховирусы (E, двадцать восемь серотипов) и энтеровирусы 68–71 (2).Однако это биологическое разделение было заменено молекулярной классификацией, основанной на секвенировании VP1 (3). Анализ последовательности человеческих энтеровирусов был, кроме того, сгруппирован по четырем видам (от EV-A до D), среди которых шесть различных видов A (CAV2, CAV4, CAV6, CAV10, CAV16 и EV71) и четыре вида серотипов B (E6, E9, E30 и CAV9) были обнаружены у маленьких детей с сепсисоподобным заболеванием в Эдинбурге и Соединенных Штатах Америки (4–6). Внутри EV вида B (все эховирусы, CBV1-6 и CAV9) были обнаружены у новорожденных с сепсисоподобным заболеванием (1–4).Энтеровирусы человека подразделяются на более чем 100 серотипов, среди которых все эховирусы, вирус Коксаки A9 (CVA9), энтеровирус 69 и энтеровирус 71 являются хорошо известными возбудителями менингита (8, 9). Человеческий энтеровирус связан с широким спектром заболеваний, от фебрильных до мультисистемных, таких как асептический менингит, паралич, миокардит и неонатальный сепсис (10). ЭВ могут передаваться как горизонтально (фекально-орально / орально-орально), так и вертикально (пренатальная инфекция). Энтеровирусы человека (EV) — частая причина неонатального сепсиса, особенно на стыке лета и осени.Инфекция возникает у детей раннего возраста, особенно летом и осенью (11). Количество вирусных патогенов у младенцев с лихорадкой (от 1 до 90 дней) в 3 раза больше, чем у бактерий (12). Эпидемиология вирусного сепсиса среди новорожденных была описана в Кувейте (3), Шотландии (4), Англии (5), США (6), Палестине (8) и Нидерландах (11).

Лабораторное обнаружение ЭВ обычно проводится с помощью ПЦР с обратной транскрипцией (ОТ-ПЦР) или ПЦР в реальном времени, которые быстрее и более чувствительны, чем культура вирусных клеток.5’-некодирующая область (NCR) является наиболее консервативной областью среди ЭВ и является мишенью для многих процедур диагностического скрининга (13). Однако последовательности из этой области предоставляют мало информации или не предоставляют никакой информации о серотипе инфицирующего вируса, и для идентификации EV и вируса Parecho человека (HPeV) требуется секвенирование области структурного гена, такой как VP1 (4, 13). Этот метод используется для выявления энтеровируса у больных сепсисом и менингитом (13, 14). VP1 является одним из белков капсида, который содержит сайт нейтрализации антигена, специфичный для серотипа.Кроме того, последовательность VP1 включает гипервариабельную область, высокую скорость мутаций и рекомбинации, поэтому анализ этой области используется для определения и филогенетической классификации серотипов энтеровирусов (15, 16). Поскольку знания о роли энтеровирусов у новорожденных с сепсисом в нашем регионе ограничены, данное исследование было направлено на определение этиологических агентов вирусного сепсиса и их молекулярную характеристику у новорожденных, госпитализированных в городе Ахваз, город Ахваз является столицей Провинция Хозестан и расположена в юго-западном регионе Ирана.

МАТЕРИАЛЫ И МЕТОДЫ

Первоначально сыворотки были собраны у 140 новорожденных, которые были госпитализированы в больницу Абозар, город Ахваз, Иран, в период с сентября 2013 г. по октябрь 2014 г. Пациенты в возрасте> 3 месяцев, образец пациента положительный на бактериальный инфекции были исключены. Культура крови была сделана для всех образцов. Пробы Twelves были положительными на бактериальные патогены и исключены из исследования. Критериями включения были пациенты в возрасте <90 дней, лихорадка> 38 ° C, раздражительность и тахикардия.Всего для этого исследования было отобрано 128 новорожденных, в том числе 56 (43,75%) женщин и 72 (56,25%) мужчин. Демография пациентов, включая пол, возраст, клинические симптомы (лихорадка, тахикардия), лабораторные параметры, такие как количество лейкоцитов, тромбоцитов, CRP (C — реактивный белок), регистрировалась для каждого человека.

Экстракция РНК и ОТ-ПЦР.

РНК

экстрагировали из 128 образцов сыворотки с использованием набора для выделения высокочистой РНК (Roche / Германия) в соответствии с протоколом производителя. КДНК была приготовлена ​​в соответствии с инструкциями поставщика (Thermo Scientific / США).Выявление генома энтеровируса проводили с помощью полувложенной ПЦР. Вакцину Сэбина использовали в качестве положительного контроля. Реакционная смесь для ПЦР состояла из 2,5 мкл буфера для ПЦР, 0,5 мкл dNTP, 0,75 мкл каждого праймера EV-F1 и EV-R (), 0,75 мкл MgCl 2 , 0,12 мкл Taq, 2,5 мкл матрицы и D / W up. до 25 мкл. Реакционную смесь подвергали термоциклеру (TC-512, Techne, UK) в течение 35 циклов амплификации (94 ° C в течение 45 с, 54 ° C в течение 45 с, 72 ° C в течение 45 с и 72 ° C в течение 10 мин. ). Затем 1 мкл продукта использовали в качестве шаблона для второго раунда, который состоял из 2.5 мкл буфера для ПЦР, 0,5 мкл dNTP, 0,75 мкл каждого праймера EV-F2 и EV-R, 0,75 мкл MgCl 2 , 1 мкл матрицы, 0,12 Taq и 18,62 мкл D / W подвергали 35 циклам амплификации (94 ° C в течение 30 секунд, 58 ° C в течение 30 секунд, 72 ° C в течение 30 секунд и 72 ° C в течение 5 минут). Конечный продукт из 155 пар оснований, подвергнутый электрофорезу в 2% геле, показал положительный результат (17).

Таблица 1.

Универсальные праймеры полугнездовой ПЦР

F2): TCCTCCGGCCCCTGAATGCG
Праймер Область генома Последовательность Размер продукта
Первый шаг 5 ′ UTR EV-1 (F1): CAAGCACTTCTGTTTCCCCGG 440 п.н. (17)
EV-R: ATTGTCACCATAAGCAGCCA
155 п. R): GCICCIGAYTGITGICCRAA

Обнаружение области VP1 энтеровируса проводили для образцов, положительных на 5UTR.Реакционная смесь для ПЦР включала 2,5 мкл 10X буфера для ПЦР, 0,5 мкл dNTP, 0,5 мкл каждого праймера VP1-F и VP1-R (), 0,12 мкл Taq, 2,5 мкл матрицы, 0,5 мкл dNTP и воду до 25 мкл подвергали воздействию термоциклер на 35 циклов амплификации (94 ° C в течение 45 секунд, 54 ° C в течение 45 секунд, 72 ° C в течение 45 секунд и 72 ° C в течение 10 минут). Конечный продукт 1000 пар оснований, подвергнутый электрофорезу на 2% геле, показал положительный результат теста.

Последовательность.

Для определения серотипов EV случайным образом были секвенированы 8 положительных образцов области VP1.Последовательности были обработаны с использованием доступных баз данных. Филогенное дерево было построено с помощью метода объединения соседей с использованием частичных нуклеотидных последовательностей области VP1 положительных образцов EV. Контрольные последовательности были получены из GenBank с использованием их номеров доступа.

Этический статус.

Этот проект с регистрационным номером ajums.REC.1392.338 был одобрен этическим комитетом Ахваза Джундишапурского университета медицинских наук в Ахвазе, Иран. Согласие было получено от каждого молодого родителя новорожденного.

Статистический анализ.

Статистический анализ проводился для переменных лейкоцитов, нейтрофилов, тромбоцитов и С-реактивного белка. Переменные были записаны как средние значения, стандартное отклонение. Для анализа ассоциации EV по полу, возрастной группе и сезону были выполнены с помощью хи-квадрат или точного критерия Фишера. Данные были проанализированы с помощью SPSS Statistics ver. 22. P Значения <0,05 считались статистически значимыми.

РЕЗУЛЬТАТЫ

Все 128 проб были отрицательными на бактериальный патоген.Геном энтеровируса был обнаружен в 50 (39,06%) образцах, включая 24 (48%) женщин и 26 (52%) мужчин, методом ПЦР. Из 50 образцов 21 образец показал положительный результат на область VP1. Анализ секвенирования 8 образцов на VP1 показал, что 7 образцов были Echovirus 30 и один образец был вирусом Коксаки A9 (). показывает распределение энтеровируса по полу, возрасту, разным сезонам, клиническим симптомам и лабораторным параметрам. и показать распределение энтеровируса по разным возрастным группам и временам года. Филогенетическое дерево с соединением соседей было построено с помощью программного обеспечения MEGA версии 6.Нуклеотидные последовательности в регионах VP1 штаммов вируса Echo 30, выделенных от пациентов с сепсисом в Ахваз-Иран, с регистрационным номером (KX771182-94), помечены черными сплошными квадратами (). Соседнее филогенетическое дерево нуклеотидных последовательностей в регионах VP1 штамма вируса Коксаки А9, выделенного от пациента с сепсисом в Ахвазе, Иран, с инвентарным номером {«type»: «entrez-нуклеотид», «attrs»: {«text «:» KX771195 «,» term_id «:» 1227950078 «,» term_text «:» KX771195 «}} KX771195 помечено черным сплошным кружком ().

VP1 ПЦР. N: Линия 1: лестница ДНК 100 п.н., Линия 2 N: Отрицательный контроль; Строка 4, P: положительный контроль; № 3, 6–14: Неизвестные образцы

Таблица 2.

Профиль новорожденных с сепсисом, ассоциированным с ЭВ.

Клинические симптомы 38–39.5 мм 3
Характеристика EV положительный % Значение P
Кол-во пациентов (n = 39194 9019 128)06%)
Пол
Женский 24/56 (18,75%) 0,438
Мужской 26/72
Возраст (дни)
1–7 15/34 (44,11%)
8–30 21/55 (38,1819%)
31–90 14/39 (35.89%)
Сезон
Зима 14/25 (56%) 0,035
Весна 15/37
Лето 31/11 (35,48%)
Осень 10/35 (28,57%)
128 (100%)
Тахикардия 39/128 (30%)
Лабораторный параметр
NA 9,790 — 28000
Абсолютное количество нейтрофилов (/ мм 3 ) NA 4,362 — 6,955
9000 мм тромбоцитов 9 ) NA 313–450
CRP C-реактивный белок (мг / л) NA 3.5 ± 1,7

A: Соседнее филогенетическое дерево было построено с помощью программного обеспечения MEGA версии 6 нуклеотидных последовательностей в регионах VP1 штаммов Echo 30, выделенных от пациентов с сепсисом в Ахвазе, Иран с регистрационным номером. (KX771182-94), полученный из банка генов и сравненный с другим Echo 30, изолированным из других регионов мира. Изоляты Ирана (Ахваз) помечены черными сплошными квадратами, а Echo 30 ({«type»: «entrez-nucleotide», «attrs»: {«text»: «KX351155», «term_id»: «1149325638», «term_text»: «KX351155»}} KX351155) Штамм-прототип Иран (Ахваз) обозначен черным сплошным кружком.Их сравнивали с другими изолятами штаммов Echo 30 из других регионов мира. Числа в ветках воспроизводятся после 1000 загрузок. Шкала шкалы = 2%. B: Соседнее филогенетическое дерево нуклеотидных последовательностей в регионах VP1 штамма вируса Коксаки А9, выделенного от пациента с сепсисом в Ахвазе, Иран, с инвентарным номером {«type»: «entrez-нуклеотид», «attrs»: { «text»: «KX771195», «term_id»: «1227950078», «term_text»: «KX771195»}} KX771195, отмеченный черным сплошным кружком.Его сравнивали с другими изолятами вируса Коксаки A9 из других регионов мира. Числа в ветвях воспроизводятся после 1000 бутстрепов. Масштабная шкала = 0,1

Распределение энтеровируса среди разных возрастных групп.

Частота энтеровируса в разные сезоны. Номера доступа GenBank для последовательностей VP1 были следующими: {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KX771188», «term_id»: «1227950064», «term_text»: «KX771188» }} KX771188, {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KX771189», «term_id»: «1227950066», «term_text»: «KX771189»}} KX771189, {«type «:» entrez-нуклеотид «,» attrs «: {» text «:» KX771190 «,» term_id «:» 1227950068 «,» term_text «:» KX771190 «}} KX771190, {» type «:» entrez-nucleotide » , «attrs»: {«text»: «KX771191», «term_id»: «1227950070», «term_text»: «KX771191»}} KX771191, {«type»: «entrez-нуклеотид», «attrs»: {» text «:» KX771192 «,» term_id «:» 1227950072 «,» term_text «:» KX771192 «}} KX771192, {» type «:» entrez-нуклеотид «,» attrs «: {» text «:» KX771193 «, «term_id»: «1227950074», «term_text»: «KX771193»}} KX771193 и {«type»: «entrez-nucleotide», «attrs»: {«text»: «KX771194», «term_id»: «1227950076» , «term_text»: «KX771194»}} KX771194 и {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KX771195», «term_id»: «1227950078», «term_text»: «KX771195 «}} KX771195.

ОБСУЖДЕНИЕ

Сепсис у новорожденных и младенцев грудного возраста является важным клиническим явлением, которое приводит к большому количеству госпитализаций ежегодно. По оценкам, около 0,6–3% младенцев повторно госпитализируются с подозрением на сепсис в первый месяц жизни, и большинство пациентов инфицированы энтеровирусом (19).

Эта вспышка, вероятно, является одной из первых крупных вспышек энтеровирусов, зарегистрированных в городе Ахваз, Иран. Результаты этого опроса помогут свести к минимуму ненужное использование противомикробных препаратов и уменьшить количество ненужных госпитализаций.Синдромный надзор с использованием данных отделения неотложной помощи оказался полезным и правильным способом мониторинга госпитализаций отделений неотложной помощи в связи со вспышкой энтеровирусов.

В нашем исследовании описана частота инфекций ЭВ в сыворотке крови новорожденных с подозрением на сепсис в Ахвазе, Иран, с сентября 2013 г. по октябрь 2014 г. В настоящем исследовании геном энтеровируса был обнаружен в 50/128 (39,06%) образцах, включая 24 (18,75%) женщин и 26 (20,31%) мужчин ( р, = 438).Частота обнаружения ЭМ у новорожденных варьировала в разных регионах мира.

Harvala et al. в Эдинбурге исследовали этот феномен в течение восьми лет и сообщили, что 58% новорожденных с сепсисом были положительными на ЭВ (4). Maguire et al. обнаружили энтеровирусы у 29% новорожденных с сепсисом в Англии и Уэльсе (5). Хецуриани и др. обнаружили ЭВ у 44% новорожденных с сепсисом в США, что согласуется с нашими выводами (20).

Verboon-Maciolek et al.диагностировали ЭМ у 57% новорожденных с синдромом сепсиса в Нидерландах, что показывает более высокий процент, чем наш результат (11). Джордан из Испании сообщил, что 10/72 (13,88%) новорожденных с лихорадкой были положительными на ЭМ, что указывает на более низкий процент, чем наш результат (21). В нашем исследовании 7/8 (87,5%) новорожденных с сепсисом оказались положительными на вирус Echo 30, в то время как 1/8 (12,5%) случаев были положительными на вирус Коксаки A9. И Echo virus 30, и вирус Коксаки A9 принадлежат к видам энтеровирусов B и были связаны с пациентами с сепсисом.О роли видов энтеровирусов B у новорожденных с сепсисом сообщали другие исследователи (4–6). Частота вируса Echo 30 оказалась доминирующей среди новорожденных в нашем регионе. Harvala et al. описали E9, CAV9, CBV5, E6, E11, E30, CAV2, CAV4, CAV6, CAV10, CAV16 и EV71 как связанные с сепсисоподобным заболеванием, среди которых E6, E9, E30 и CAV9 являются наиболее распространенными выделенными серотипами. из клинических образцов в Великобритании и США (4, 19, 20). Джи-Хён Со и др.описали обнаружение энтеровируса среди детей раннего возраста с заболеванием, похожим на сепсис, на уровне 7,5% в Чинджу, Корея (22). Следует учитывать, что причина расхождения в распространенности между различными другими исследованиями, и это может быть связано с чувствительностью используемого метода или типов образцов.

В нашем исследовании ЭВ наблюдались у новорожденных с сепсисом в любое время года: осенью (28,57%), зимой (56%), весной (40,54%) и летом (35,48%). Максимальное обнаружение EV наблюдалось в зимний сезон, а самое низкое — осенью (28.57%) ( р = 0,035). Наши результаты показывают, что инфекция HEV происходит в течение всего года, а не только весной и летом, тогда как Harvala et al. 2011 (Эдинбург, Великобритания) и Ju-Young Chung et al. 2015 г. (Чинджу, Южная Корея) описал пик обнаружения электромобилей весной (22, 23). Han et al. 2013 (Сеул, Корея) и Walters et al. (Чикаго, США) описали, что пиковый сезон для обнаружения электромобилей приходился на лето (24, 25).

В Иране частота энтеровируса у новорожденных, согласно сообщениям, в городе Мешхед составляла 37% (26), а в Тегеране — 32% (27).Rasti et al описали, что обнаружение ЭМ у детей в возрасте до одного года с асептическим менингитом составляет 55,8% в Ахвазе (28).

В настоящем исследовании 78/128 (60,93%) пациентов с сепсис-подобным синдромом показали отрицательный результат на ЭВ. Было признано, что пареховирусы являются важными агентами сепсиса у новорожденных (29, 30, 31). Среди них более доминирующей является роль пареховируса 3 в связи с сепсисоподобным синдромом у новорожденных (29, 30). В настоящем исследовании сыворотка пациентов использовалась для обнаружения ЭВ.Сыворотка не хуже, чем CSF, в качестве диагностического инструмента для системной энтеровирусной инфекции, хотя для подтверждения этого наблюдения следует проанализировать больше пациентов. Быстрая диагностика энтеровирусной инфекции у детей грудного возраста важна для предотвращения и сокращения использования антибиотиков широкого спектра действия и, возможно, для указания того, что в тяжелых случаях следует начинать противовирусное лечение. Было продемонстрировано, что быстрая диагностика энтеровирусной болезни значительно сокращает пребывание в больнице и затраты (19).

ЗАКЛЮЧЕНИЕ

Результаты этого опроса показывают, что частота ЭВ среди пациентов с сепсисом составляла 39.06%. Среди положительных случаев ЭВ у молодых новорожденных с вирусным сепсисом наблюдалась высокая частота 14% эховирусов 30 и низкая распространенность 2% вируса Коксаки А9. 78 (60,93%) пациентов показали отрицательный результат на ЭВ. Необходимо изучить роль пареховируса. Синдромный эпиднадзор — полезный косвенный индикатор, который следует учитывать для будущего выявления и надзора за сезонными вспышками энтеровирусных инфекций. Эта вспышка, вероятно, является одной из первых вспышек энтеровируса, зарегистрированных в Ахвазе, Иран.Результаты этого опроса помогут свести к минимуму ненужное использование противомикробных препаратов и уменьшить количество ненужных госпитализаций.

БЛАГОДАРНОСТИ

Это исследование было проведено как исследовательский проект с регистрационным номером OG-92154, выполненный Абдольнаби Шабани (магистр наук, вирусология). Этот проект получил финансовую поддержку Исследовательского центра инфекционных и тропических заболеваний, Научно-исследовательского института здравоохранения, Университета медицинских наук Ахваза Джундишапура, Ахваз, Иран. Авторы высоко оценивают все старания сотрудников лаборатории Абузарской детской больницы, в том числе предоставление образцов для исследований.Этот проект поддержан Исследовательским центром инфекционных и тропических болезней.

СПИСОК ЛИТЕРАТУРЫ

1. Ноулз Н.Дж., Хови Т., Хюпия Т., Кинг AMQ., Линдберг А.М., Палланш М.А., Пальменберг А.С., Скерн Т., Стэнвей Г., Ямашита Т., Целл Р. Picornaviridae. В: King AMQ., Adams MJ., Carstens EB., Lefkowitz EJ., Редакторы. Таксономия вирусов: классификация и номенклатура вирусов: девятый доклад международного комитета по таксономии вирусов. Эльзевир; Сан-Диего: 2011. стр. 855–880. [Google Scholar] 2.Ноулз Нью-Джерси, Хови Т., Хюипи Т., Кинг А.М., Линдберг А.М., Палланш М.А. и др. Picornaviridae. В: King AM, Adams MJ, Carstens EB, Lefkowitz EJ, редакторы. Таксономия вирусов: классификация и номенклатура вирусов. Девятый доклад Международного комитета по таксономии вирусов. Сан-Диего: Эльзевьер; 2012. с. 855–80. [Google Scholar] 3. Ахмад С., Далвай А., Аль-Накиб В. Частота обнаружения энтеровируса в образцах крови новорожденных, госпитализированных с сепсисоподобным заболеванием в Кувейте. J Med Virol 2013; 85: 1280–1285.[PubMed] [Google Scholar] 4. Харвала Х., Калверт Дж., Ван Нгуен Д., Класпер Л., Гэдсби Н., Молино П. и др. Сравнение диагностических клинических образцов и образцов окружающей среды для эпиднадзора за энтеровирусами и пареховирусами в Шотландии, 2010–2012 гг. Euro Surveill 2014; 19 (15): 20772. [PubMed] [Google Scholar] 5. Магуайр ХК, Аткинсон П., Шарланд М., Бендиг Дж. Энтеровирусные инфекции в Англии и Уэльсе: данные лабораторного наблюдения: с 1975 по 1994 год. Общественное здравоохранение. 1999; 2: 122–125. [PubMed] [Google Scholar] 6.Шарп Дж., Харрисон С.Дж., Пакетт К., Селвараджу С.Б., Пенаранда С., Никс В.А. и др. Характеристики младенцев, у которых пареховирус человека, энтеровирус, или ни то, ни другое не было обнаружено в спинномозговой жидкости во время оценки сепсиса. Педиатр Infect Dis J 2013; 32: 213–216. [Бесплатная статья PMC] [PubMed] [Google Scholar] 7. Greenhow TL, Hung YY, Herz AM. Изменение эпидемиологии бактериемии у младенцев в возрасте от 1 недели до 3 месяцев. Педиатрия 2012; 129 (3): e590–596. [PubMed] [Google Scholar] 8. Думаиди К., Аль-Джавабрех А.Молекулярное обнаружение и генотипирование энтеровирусов в образцах спинномозговой жидкости пациентов с подозрением на сепсис-подобное заболевание и / или асептический менингит с 2012 по 2015 годы на Западном берегу, Палестина. PLoS One 2017; 12 (2): e0172357. [Бесплатная статья PMC] [PubMed] [Google Scholar] 9. Раканиелло Винсент Р. Picornaviridae: вирусы и их размножение. В: Книп Д.М., Хоули П.М., редакторы. Области вирусологии. 6 изд., Т. 1 Филадельфия: Липпинкотт Уильямс и Уилкинс; 2013. с. 610e64. [Google Scholar] 10. Капушинский Б., Сомор К.Н., Фаркаш А., Такач М., Беренси Г.Выявление неполиомиелитных энтеровирусов в Венгрии в 2000–2008 гг. И молекулярная эпидемиология энтеровируса 71, вируса Коксаки A16 и эховируса 30. Гены вирусов 2010; 40: 163–73. [PubMed] [Google Scholar] 11. Verboon-Maciolek M, Nijhuis M, Van Loon A, Van Maarssenveen N, Van Wieringen H, Pekelharing-Berghuis M и др. Диагностика энтеровирусной инфекции в первые 2 месяца жизни методом полимеразной цепной реакции в режиме реального времени. Clin Infect Dis 2003; 37: 1–6. [PubMed] [Google Scholar] 12. Byington CL, Enriquez FR, Hoff C, Tuohy R, Taggart EW, Hillyard DR, et al.Серьезные бактериальные инфекции у младенцев с лихорадкой от 1 до 90 дней с вирусными инфекциями и без них. Педиатрия 2004. 113: 1662–1666. [PubMed] [Google Scholar] 13. Эспозито С., Рахамат-Лангендоен Дж., Асколезе Б., Сенаторе Л., Кастеллацци Л., Нистерс Х. Г.. Детские пареховирусные инфекции. J Clin Virol 2014; 60: 84–89. [PubMed] [Google Scholar] 14. Wolthers KC, Benschop KS, Schinkel J, Molenkamp R, Bergevoet RM, Spijkerman IJ, et al. Человеческие пареховирусы как важная вирусная причина сепсисоподобных заболеваний и менингита у детей раннего возраста.Clin Infect Dis 2008. 47: 358–363. [PubMed] [Google Scholar] 15. Пэк К., Пак К., Юнг Э, Чунг Э, Пак Дж., Чой Х и др. Молекулярная и эпидемиологическая характеристика энтеровирусов, выделенных в Чуннам, Корея, с 2005 по 2006 год. J Microbiol Biotechnol 2009; 19: 1055–1064. [PubMed] [Google Scholar] 16. Mirand A, Henquell C, Archimbaud C, Chambon M, Charbonne F, Peigue-Lafeuille H и др. Перспективная идентификация энтеровирусов, вызывающих менингит, в 2006 г. путем прямого генотипирования спинномозговой жидкости.J Clin Microbiol 2008. 46: 87–96. [Бесплатная статья PMC] [PubMed] [Google Scholar] 17. Мохамадпур Т., Набавиния М., Голуби А., Алави М., Мешкат З. Энтеровирусы при остром инфаркте миокарда. Иран J Общественное здравоохранение 2012; 41: 71–74. [Бесплатная статья PMC] [PubMed] [Google Scholar] 18. Тан Дж., Ёсида Х., Дин З., Тао З., Чжан Дж., Тиан Б. и др. Молекулярная эпидемиология и рекомбинация энтеровирусов человека в результате эпиднадзора за ОВП в Юньнани, Китай, с 2006 по 2010 год. Sci Rep 2014; 4: 6058. [Бесплатная статья PMC] [PubMed] [Google Scholar] 19.Verboon-Maciolek MA, Nijhuis M, van Loon AM, van Maarssenveen N, van Wieringen H, Pekelharing-Berghuis MA, et al. Диагностика энтеровирусной инфекции в первые 2 месяца жизни методом полимеразной цепной реакции в режиме реального времени. Clin Infect Dis 2003; 37: 1–6. [PubMed] [Google Scholar] 20. Хецуриани Н., Ламонте-Фаулкес А., Оберсте С., Палланш М.А. Эпиднадзор за энтеровирусами — США, 1970–2005 гг. MMWR Surveill Summ 2006; 55: 1–20. [PubMed] [Google Scholar] 21. Йордан I, Эстева Ц., Эстебан Э., Ногера А., Гарсия Х. Дж., Муньос-Альмагро К.Тяжелая энтеровирусная болезнь у новорожденных с лихорадкой. Энферм Инфекк Микробиол Клин 2009. 27: 399–402. [PubMed] [Google Scholar] 22. Со Джи-Хён, Ём Чжон Сук, Ён Хи-Шан, Хан Тэ-Хи, Чунг Джу Ён. Распространенность пареховируса человека и энтеровируса в образцах спинномозговой жидкости у детей в Чинджу, Корея. Корейский J Pediatr 2015; 58: 102–107. [Бесплатная статья PMC] [PubMed] [Google Scholar] 23. Harvala H, McLeish N, Kondracka J, McIntyre CL, McWilliam, Leitch EC и др. Сравнение частот обнаружения пареховируса человека и энтеровируса в образцах спинномозговой жидкости, собранных за 5-летний период в Эдинбурге: HPeV типа 3 идентифицирован как наиболее распространенный тип пикорнавирусов.J Med Virol 2011; 83: 889–896. [PubMed] [Google Scholar] 24. Хан TH, Chung JY, You SJ, Youn JL, Shim GH. Инфекция пареховируса человека-3 у детей, Южная Корея. J Clin Virol 2013; 58: 194–199. [PubMed] [Google Scholar] 25. Уолтерс Б., Пенаранда С., Никс В.А., Оберсте М.С., Тодд К.М., Кац Б.З. и др. Обнаружение пареховируса человека (HPeV) -3 в образцах спинномозговой жидкости от педиатрических пациентов в районе Чикаго. J Clin Virol 2011; 52: 187–191. [PubMed] [Google Scholar] 26. Шахруди М.Дж., Газвини К., Садеги Р., Сасан М.С.Энтеровирусный менингит у новорожденных и детей в Мешхеде, Иран. Джундишапур Дж Микробиол 2016; 9 (5): e19955. [Бесплатная статья PMC] [PubMed] [Google Scholar] 27. Рахими П., Махдиан Насер Х., Сохраби А. Связь неполиомиелитных энтеровирусов с асептическим менингитом у детей в Иране. JoMMID 2014; 2: 56–60. [Google Scholar] 28. Моджтаба Р., АлиРеза С.З., Манучер М., Ахмад С.З. Относительная частота энтеровирусов у детей с асептическим менингитом, поступивших в больницу Абузар в Ахвазе. Джундишапур Дж Микробиол 2012; 5: 456–459.[Google Scholar] 29. Тан Дж. У., Холмс К. В., Эльсануси Ф. А., Патель А., Адам Ф., Спейт Р. и др. Кластер инфекций пареховируса человека как преобладающей причины сепсиса у новорожденных и младенцев, Лестер, Соединенное Королевство, 8 мая — 2 августа 2016 г. Euro Surveill 2016; 21 (34): 30326. [Бесплатная статья PMC] [PubMed] [Google Scholar] 30. Braccio S, Kapetanstrataki M, Sharland M, Ladhani SN. Поступления в реанимацию для детей с энтеровирусными и пареховирусными инфекциями человека в Соединенном Королевстве и Ирландии, 2010–2014 гг.Педиатр Infect Dis J 2017; 36: 339–342. [PubMed] [Google Scholar] 31. Колехмайнен Пекка, Сипонен Ану, Смура Теему, Каллио-Коккок Ханнимари, Вапалахти Олли, Яэскеляйнен Анне и др. Межтиповая рекомбинация пареховируса человека 4, выделенного от младенцев с сепсисоподобным заболеванием. J Clin Virol 2017; 88: 1–7. [PubMed] [Google Scholar]

Вирус Коксаки A — обзор

Энтеровирусы

Неполиомиелитные энтеровирусы представляют собой одноцепочечные РНК-вирусы, принадлежащие к семейству Picornaviridae и включают вирусы Коксаки A и B, эховирусы и «пронумерованные» энтеровирусы.Инфекция новорожденных вирусами Коксаки и эховирусами может быть результатом трансплацентарной передачи вируса, контакта с инфицированными выделениями во время родов и контакта человека с человеком после рождения. Вирусные и эховирусные инфекции Коксаки у новорожденных вызывают широкий спектр клинических проявлений, от бессимптомной инфекции до смертельного гепатита, энцефалита, миокардита и диссеминированного внутрисосудистого свертывания крови. Наиболее частые проявления неспецифичны, в том числе лихорадка, раздражительность и вялость, что приводит к оценке бактериального сепсиса.У некоторых младенцев появляется пятнисто-папулезная сыпь. Хотя энтеровирусные инфекции, как правило, возникают зимой и осенью, в неонатальном периоде наблюдается меньшая сезонность. 90 Часто в анамнезе недавно было заболевание матери или другого близкого контакта. 91

Вирусы, связанные с тяжелым гепатитом, часто с некрозом печени, включают эховирус 6, энтеровирус 71 и вирусы Коксаки B1-4. 92-94 Кальцификации печени могут развиться у лиц, переживших гепатит, вызванный вирусом Коксаки B1.

Образцы, обеспечивающие наибольший выход вирусных культур, представляют собой мазки или жидкости, полученные из дыхательных или желудочно-кишечных трактов или из спинномозговой жидкости. Диагноз также может быть поставлен путем обнаружения энтеровирусной РНК с помощью ПЦР с обратной транскриптазой. Серологические исследования имеют ограниченную ценность из-за низкой чувствительности, связанной с отсутствием общего антигена у очень многих антигенно различных энтеровирусов. 95

Лечение в первую очередь поддерживающее. Плеконарил является наиболее многообещающим противовирусным средством 96 и в настоящее время оценивается в многоцентровом рандомизированном двойном слепом плацебо-контролируемом исследовании.Внутривенный иммунный глобулин (IVIg) использовался как для постконтактной профилактики, так и для лечения, но убедительных доказательств его эффективности не существует. Сообщается, что у новорожденных с тяжелым гепатитом смертность составляет от 24 до 31% в более крупных исследованиях и до 71%, если миокардит также очевиден. 92,97 У большинства выживших нет остаточной печеночной недостаточности.

Инфекции вируса Коксаки — Knowledge @ AMBOSS

Последнее обновление: 13 августа 2021 г.

Резюме

Вирусы Коксаки — это группа РНК-вирусов с более чем 20 серотипами; в зависимости от конкретных вирусных характеристик эти серотипы делятся на группы A и B.Инфекция связана с широким спектром симптомов, которые зависят от конкретного серотипа. Болезни кистей, стопы и рта (HFMD) и герпангина обычно вызываются вирусами Коксаки группы А, в то время как плевродиния и миокардит вызываются вирусами Коксаки группы B. Обе группы могут вызывать вирусный менингит, конъюнктивит или пневмонию. Диагностические процедуры и лечение должны быть адаптированы к конкретному проявлению заболевания.

Эпидемиология

  • Распространение по всему миру
  • Встречаются во всех возрастных группах
  • Самая высокая заболеваемость у младенцев и детей младшего возраста () [1]

Эпидемиологические данные относятся к США, если не указано иное.

Этиология

Проявления болезни

Инфекция, вызванная вирусом Коксаки А

[2]

Герпетическая ангина

  • Определение: сезонная острая инфекция, которая проявляется лихорадкой, болью в горле и герпесоподобными поражениями задней части ротоглотки и миндалин.
  • Эпидемиология
    • Наиболее часто встречается у детей в возрасте от 3 до 10 лет.
    • Встречается преимущественно летом и осенью
  • Клинические особенности
  • Диагноз: на основании клинических особенностей
  • Лечение: поддерживающая терапия (например, поддерживающая терапия).g., ибупрофен для обезболивания, парентеральная регидратация при обезвоживании), поскольку состояние обычно самоограничивается

Болезнь рук, стоп и рта

  • Определение: очень заразная инфекция, которая проявляется характерной пятнисто-папулезной / частично везикулярной сыпью на руках и ногах
  • Клинические особенности
  • Диагноз: на основании клинических особенностей
  • Лечение: симптоматическое.
  • Прогноз: почти всегда самоограничивающийся

Другие проявления

Инфекция, вызванная вирусом Коксаки B

[2]

Плевродиния

[3]
  • Определение: острое заболевание, характеризующееся лихорадкой и / или другими гриппоподобными симптомами и болезненными спазмами грудной клетки и верхней части живота из-за раздражения плевры и мышц
  • Клинические особенности
    • Гриппоподобные симптомы
    • Внезапная боль в грудной клетке и верхней части живота, вызванная раздражением плевры и мышц.
  • Диагноз
    • Клинический
    • Посев на вирус или ПЦР (образец глотки или кала), серологическое исследование
    • Креатинкиназа может быть повышена [4]
  • Лечение: симптоматическое.
  • Прогноз: самоограничивающийся

Другие проявления

Коксаки B является наиболее частой причиной вирусного миокардита.

Ссылки

  1. Modlin JF. Клинические проявления и диагностика энтеровирусных и пареховирусных инфекций. В: Сообщение TW, под ред. UpToDate . Уолтем, Массачусетс: UpToDate. https://www.uptodate.com/contents/clinical-manifestations-and-diagnosis-of-enterovirus-and-parechovirus-infections . Последнее обновление: 30 сентября 2016 г. Дата обращения: 19 марта 2017 г.
  2. Эпидемическая плевродиния (болезнь Борнхольма; болезнь Борнхольма). http: // www.merckmanuals.com/professional/infectious-diseases/enteroviruses/epidemic-pleurodynia . Обновлено: 1 января 2016 г. Доступ: 19 марта 2017 г.
  3. Болезнь Борнхольма. https://radiopaedia.org/articles/bornholm-disease-1 . Обновлено: 30 апреля 2020 г. Доступ: 29 июля 2020 г.
  4. Карлин Б. Корсино, Римша Али, Дерек Р. Линклейтер .. Герпетическая ангина — StatPearls. StatPearls .2020 г. .

Энтеровирусные инфекции | DermNet NZ

Автор: Ванесса Нган, штатный автор, 2008 г. Обновлено доктором Джаннет Гомес, аспирантом в области клинической дерматологии, Университет Королевы Марии, Лондон, Соединенное Королевство; Главный редактор: д-р Аманда Окли, дерматолог, Гамильтон, Новая Зеландия, декабрь 2016 г.


Что такое энтеровирусные инфекции?

Энтеровирусные инфекции охватывают широкий спектр заболеваний, вызываемых энтеровирусами (ЭВ).Они являются членами семейства Picornaviridae , которые представляют собой небольшие икосаэдрические одноцепочечные вирусы с положительной РНК.

Самым известным из энтеровирусов является полиовирус (ПВ), но он в основном ликвидирован. Другими энтеровирусами являются вирусы Коксаки A и B (CVA и CVB) и эховирусы (ECHO: энтеросолюбильный цитопатический сиротский вирус человека).

Как классифицируются энтеровирусы?

Энтеровирусы были разделены на пять групп в зависимости от их молекулярных свойств.

  1. Полиовирус: PV1 – PV3
  2. EV A человека (HEV-A): CVA2 – CVA9, CVA10, CVA12, CVA14, CVA16 и EV71
  3. EV B человека (HEV-B): CVA9, CVB1 – CVB6, E1 – E7, E9, E11 – E21, E24 – E27, E29 – E33, EV69
  4. EV C человека (HEV-C): CVA1, CVA11, CVA13, CVA15, CVA17 – CVA22, CVA2
  5. EV D человека (HEV-D): EV68, EV70, EV73 – EV75, EV77 – EV78

Энтеровирусы являются причиной многих болезней, в том числе простуды. Некоторые из вирусов Коксаки, эховирусов и EV71 вызывают экзантемы (кожная сыпь или кожная сыпь как симптом более общего заболевания) или энантемы (сыпь на слизистых оболочках).Кожные проявления в некоторых случаях могут быть тяжелыми и нетипичными.

Кто заражается энтеровирусными инфекциями?

Энтеровирусные инфекции широко распространены, и, по оценкам, ежегодно им заражается более одного миллиарда человек во всем мире. В Соединенных Штатах от 30 000 до 50 000 госпитализаций ежегодно происходят из-за энтеровирусных инфекций. В группу риска входят:

  • Младенцы и дети
  • Новорожденные, инфицированные от матери
  • Пациенты с ослабленным иммунитетом
  • Люди из низших социально-экономических групп.

Как распространяются энтеровирусные инфекции?

Энтеровирусные инфекции очень заразны. Энтеровирусы передаются от человека к человеку через:

  • Орально-оральные пути; например, вирусы переносятся воздушно-капельным путем и передаются, когда кто-то кашляет и чихает
  • Передача через рот и фекалии
  • Прямой контакт с жидкостью из кожных поражений
  • От матери к ребенку в послеродовой период.

Инкубационный период энтеровирусов обычно составляет 2–5 дней.Как только кто-то заражается, энтеровирусы имплантируются и размножаются в пищеварительном тракте.

Если инфекция остается локализованной, симптомы обычно отсутствуют. Однако, если вирус попадает в лимфатическую систему, может развиться общее ухудшение самочувствия. Если вирус распространяется в кровоток, возникают более серьезные симптомы.

Какие энтеровирусные инфекции вызывают кожные симптомы?

Многие энтеровирусы вызывают заболевания, сопровождающиеся кожными или слизистыми реакциями.

Герпетическая ангина

  • Герпетическая ангина вызывается Коксаки группы А, Коксаки В, энтеровирусом 71 и эховирусом.
  • Поражения развиваются на слизистых оболочках, чаще всего на передних миндалинах, небном язычке и мягком небе рта.
  • Поражения характеризуются крошечными серо-белыми папуловезикулами диаметром около 1-2 мм.
  • Они проходят самостоятельно и разрешаются в течение 5–10 дней.
  • Общие симптомы включают высокую температуру, головную боль, боль в горле, затрудненное глотание, рвоту и боль в животе.

Заболевание рук, ящура и рта

  • Заболевание рук, ящура (энтеровирусный стоматит) вызывается вирусом Коксаки А16 и энтеровирусом 71.
  • Поражения полости рта развиваются где угодно во рту, но чаще всего появляются на твердом небе, языке, щеке и деснах.
  • Поражения полости рта начинаются с эритематозных пятен и папул (плоских воспаленных красных пятен) диаметром 2–8 мм и прогрессируют с образованием тонкостенных пузырьков (пузырей), которые лопаются и образуют болезненные язвы, окруженные красным ореолом.Они заживают без лечения в течение 5–10 дней.
  • Поражения кожи появляются одновременно или вскоре после поражений полости рта. На руках и ногах может быть от нескольких до более 100 повреждений.
  • Поражения кожи начинаются с эритематозных пятен или папул, которые быстро превращаются в маленькие серые пузырьки, окруженные красным ореолом. Эти поражения спонтанно рассасываются в течение 7–10 дней без образования рубцов.

Бостонская экзантема

  • Бостонская экзантема вызывается эховирусом 16.
  • После непродолжительной лихорадки внезапно появляются розовые пятна и папулы на лице и туловище, реже на конечностях.
  • Небольшие язвы также могут быть обнаружены на мягком небе и миндалинах.

Эруптивный псевдоангиоматоз

  • Эруптивный псевдоангиоматоз вызывается эховирусом 25 и 32, вирусом Коксаки B, вирусом Эпштейна-Барра и ЦМВ.
  • На лице, туловище и конечностях развивается до десяти вишнево-красных поражений.
  • Псевдоангиомы имеют диаметр 2–4 мм и напоминают вишневые ангиомы.
  • Они проходят спонтанно в течение десяти дней.

Другие кожные особенности иногда наблюдаются при энтеровирусных инфекциях и включают:

См. Изображения энтеровирусов.

Каковы осложнения энтеровирусных инфекций?

Менее 1% энтеровирусных инфекций приводит к тяжелым симптомам. Иногда энтеровирусы могут вызывать осложнения со стороны сердца и нервной системы, такие как миокардит, асептический менингит, менингоэнцефалит и паралич.

Как диагностируются энтеровирусные инфекции?

Диагностика энтеровирусных инфекций в первую очередь основывается на клинических данных.

  • ПЦР-анализ энтеровирусов помогает подтвердить наличие патогенов.
  • Серологическое тестирование и посев вируса проводятся в редких случаях.

Как лечить энтеровирусные инфекции?

Лечение ограничивается поддерживающей терапией.

  • Мытье рук (особенно после смены подгузников) и личная гигиена
  • Дезинфекция поверхностей и предметов
  • Избегать близкого контакта
  • Увлажнение большим количеством жидкости
  • Жаропонижающие средства, такие как парацетамол от лихорадки
  • Ополаскиватели для рта, содержащие местные анестетики (лидокаин 2%) и антигистаминные препараты (например, гидрохлорид дифенгидрамина) для облегчения боли во рту

Внутривенный иммуноглобулин применялся для лечения энтеровирусной инфекции у младенцев с симптомами.

Противовирусный препарат плеконарил оказался эффективным средством лечения некоторых тяжелых энтеровирусных инфекций. Плеконарил недоступен в Новой Зеландии (декабрь 2016 г.).

Каковы исходы энтеровирусных инфекций?

Большинство энтеровирусных инфекций излечиваются спонтанно в течение 7–10 дней. Кожные поражения заживают без рубцевания.

Ссылки

  • Mathes EF, Oza V, Frieden IJ, et al.Экзема коксаки и необычные кожные проявления во время вспышки энтеровируса. Педиатрия. 2013; 132 (1): e149–57. doi <: 10.1542 / peds.2012-3175. PubMed Central
  • Ван, Ши-Мин и Цин-Чуань Лю. Энтеровирус 71: эпидемиология, патогенез и лечение. Экспертный обзор противоинфекционной терапии 7.6 (2009): 735–42. Журнал
  • Pons-Salort M, Parker EPK, Грассли, Северная Каролина. Эпидемиология неполиомиелитных энтеровирусов: последние достижения и нерешенные вопросы. Curr Opin Infect Dis. 2015 Октябрь.28 (5): 479–87. PubMed
  • Hopper SM, Babl FE, McCarthy M, Tancharoen C, Lee KJ, Oakley E. Двойное слепое рандомизированное плацебо-контролируемое исследование местного 2% вязкого лидокаина для улучшения перорального приема у детей с болезненными инфекционными заболеваниями полости рта. BMC Pediatr. 2011 21 ноября, 11: 106. PubMed Central
  • Hawkes MT, Vaudry W. Неполиомиелитная энтеровирусная инфекция у новорожденных и младенцев. Педиатрия и детское здоровье. 2005. 10 (7): 383–8. PubMed Central

В DermNet NZ

Другие веб-сайты

Книги о кожных заболеваниях

Вирус Коксаки у детей: насколько это серьезно?

У моей трехлетней внучки вирус Коксаки.Это происходит вокруг ее ухода за детьми. Это серьезное заболевание?

Ответ Джея Л. Хокера, доктора медицины

Большинство инфекций, вызванных вирусом Коксаки, не являются серьезными. Обычно они вызывают только легкие признаки и симптомы, например:

  • Лихорадка
  • Сыпь
  • Боль в горле
  • Боль в суставах
  • Головная боль

Вирус Коксаки — иногда пишется двумя словами, вирус Коксаки — принадлежит к группе вирусов, называемых энтеровирусами. Инфекции, вызванные вирусом Коксаки, чаще всего возникают у маленьких детей, обычно летом и осенью.

Специального лечения инфекций, вызванных вирусом Коксаки, не существует. Антибиотики неэффективны при лечении вируса Коксаки или любой другой вирусной инфекции. Врачи обычно рекомендуют отдых, жидкости и безрецептурные обезболивающие или жаропонижающие, когда это необходимо.

В большинстве случаев инфекция, вызванная вирусом Коксаки, проходит без осложнений и разрешается в течение недели или около того. Если у вашей внучки появляются более серьезные признаки или симптомы, такие как сильные головные боли, боли в суставах или высокая температура, ее следует осмотреть врачом.Инфекция, вызванная вирусом Коксаки, может привести к менингиту, и в редких случаях у ребенка, инфицированного вирусом Коксаки, может развиться тяжелое заболевание, которое может потребовать госпитализации.

18 августа 2020 г. Показать ссылки
  1. Modlin JF. Эпидемиология, патогенез, лечение и профилактика энтеровирусных и пареховирусных инфекций. http://www.uptodate.com/home. По состоянию на 22 февраля 2017 г.
  2. Modlin JF. Клинические проявления и диагностика энтеровирусных и пареховирусных инфекций.http://www.uptodate.com/home. По состоянию на 22 февраля 2017 г.
  3. Longo DL, et al., Eds. Энтеровирусные инфекции. В: Принципы внутренней медицины Харрисона. 19 изд. Нью-Йорк, штат Нью-Йорк: образование McGraw-Hill; 2015. http://accessmedicine.mhmedical.com. По состоянию на 22 февраля 2017 г.
  4. Обзор энтеровирусных инфекций. Руководство Merck Professional Version. https://www.merckmanuals.com/professional/infectious-diseases/enteroviruses/overview-of-enterovirus-infections. По состоянию на 22 февраля 2017 г.
Посмотреть больше ответов экспертов

.

Структурная основа нейтрализации эховируса, ассоциированного с безжелтушным гепатитом, с помощью мощного нейтрализующего антитела

Энтеровирусы человека (HEV) — это повсеместно распространенные патогены, вызывающие множество заболеваний человека, начиная от ящура, менингита и заканчивая полиомиелитом, энцефалитом и т. Д. 1 .HEV включают четыре основные группы: энтеровирус A – D (HEV-A, B, C и D), среди которых HEV-B является самой большой группой, включая вирус Коксаки A9 (CVA9), вирус Коксаки B1–6 (CVB1–6), и более 30 серотипов эховирусов. Эховирус 3 (E3), серотип HEV-B, впервые выделенный в 1953 году, приводит к очень заразным и тяжелым заболеваниям у людей, таким как асептический менингит, миокардит и безжелтушный гепатит 2 . Инфекция у новорожденных и младенцев в первые несколько недель жизни может привести к летальному исходу. В настоящее время не существует одобренных вакцин или противовирусных препаратов для лечения инфекций, вызванных вирусами, принадлежащими к группе HEV-B.

Хотя атомные структуры для множества HEV были изучены 3,4,5,6,7,8 , большие пробелы в наших знаниях относительно структурных детерминант для специфичности между серотипами / подгруппами и иммуногенных характеристик для серотип-специфичных или перекрестных -реактивные эпитопы внутри HEV-B все еще существуют. Следовательно, глубокое понимание структурных, иммуногенных свойств и ключевых эпитопов E3 должно быть полезным в качестве руководства по рациональному дизайну лекарств против инфекций HEV-B.Мы получили вирус E3 (штамм генотипа HNWY-01) из Провинциального центра по контролю и профилактике заболеваний (CDC) и размножили его в клетках RD. После раундов очистки и анализов были идентифицированы три типа частиц, один из которых содержал значительные количества вирусной РНК, характеризуемой как зрелый вирус (или полная частица, F-частица), а два других были пустыми внутри с существенно разными размерами, определяемыми как расширенные и компактные. пустые частицы (EE- и EC-частицы) (дополнительный рис.S1). Криоэлектронно-микроскопические (крио-ЭМ) структуры трех типов частиц: F-частицы (~ 64%), EC-частицы (~ 3%) и EE-частицы (~ 33%) были реконструированы до 3,2 Å, Разрешение 3,8 Å и 3,1 Å соответственно (рис. 1a; дополнительные рис. S2a и S3a – c и таблица S1). Внешние поверхности F- и EC-частиц диаметром ~ 325 Å неразличимы, за исключением некоторого беспорядка внутри EC-частицы, включая N-концы VP1 и VP0 (рис. 1а). Напротив, EE-частица имеет типичную расширенную форму с a ~ 4.Увеличение диаметра на 5% (~ 340 Å) и заметные перфорации на двумерных икосаэдрических осях (рис. 1а; дополнительные рис. S4 и S5d). Наложение асимметричных единиц (протомеров) подтверждает сходство капсидных структур F- и EC-частиц и выявляет существенные конформационные различия между F- и EE-частицами в нескольких открытых петлях, таких как VP1 BC, DE, EF и HI петли. , VP3, петли EF и GH (дополнительные рисунки S4 и S5a – c). Примечательно, что большинство этих петель являются ключевыми детерминантами иммуногенности в HEV, что указывает на то, что ЕС-частица, а не EE-частица, имеет больший потенциал в качестве кандидатов для разработки вакцины.Включение EE-частиц в вакцину потребует рациональной стратегии для облегчения структурного перехода от расширенного состояния к компактному.

Рис. 1: Структурный, биохимический и иммуногенный анализ частиц E3.

a Поверхностные представления E3 F-, EC- и EE-частиц и тонкие срезы соответствующих центральных сечений, рассматриваемые вдоль осей двойного сечения, соответственно. Поверхность вируса окрашена в цвет радуги в зависимости от расстояния вирусных элементов от центра, начиная с синего (ближайшего) через зеленый, желтый и от оранжевого до красного (дальше от центра). b Эволюционные отношения на основе структуры между репрезентативными вирусами из HEV-B: E18, эховирус 18; E3, эховирус 3; CVB1, вирус Коксаки B1; E6, эховирус 6; E30, эховирус 30; CVB5, вирус Коксаки B5; CVB3, вирус Коксаки В3; E1, эховирус 1; CVA9, вирус Коксаки А9; E11, эховирус 11. c Сравнение поверхности F-частицы E3 с поверхностью других репрезентативных представителей HEV-B (E18 (PDB: 6HBG), CVB3 (PDB: 4GB3) и CVA9 (PDB: 1D4M)) . Цветовая гамма такая же, как у и .«Меза», расположенная вверху, отмечена черным пунктирным квадратом для каждой частицы. d Структурные детали протомера (VP1: синий; VP2: зеленый; VP3: красный) репрезентативных частиц. Петли, окружающие стенки каньона (петля VP1 BC, петля VP1 GH и петля VP2 EF), и петли, окружающие структуры «мезы», отмечены соответствующими цветами. e Аффинность связывания F-частицы E3 с IgG 5G3, оцененная с помощью SPR. f Нейтрализация E3 с помощью 5G3 с использованием теста нейтрализации уменьшения образования зубного налета (PRNT).Значение Neut 50 для 5G3 составляло 0,34 нМ. г Поверхностное изображение комплекса E3-5G3. Вирусный капсид окрашен так же, как в a , а Fab 5G3 окрашен в голубой цвет. ч. 5G3 Fab-занятость (слева) и эпитопы (справа), расположенные на вирусном пентамере. Пентамер показан как поверхность (слева) и рисунок (справа) соответственно. Остатки, содержащие эпитоп 5G3, показаны сферами. i Интерфейс привязки E3–5G3. 5G3 показаны в виде карикатуры, а E3 — в виде поверхности.Остатки С-конца VP1 (синий) вставляются в гидрофобный карман 5G3 Fab. Изменение цвета отражает гидрофильную или гидрофобную природу остатков, от белого (гидрофильный) до голубого (гидрофобный). Остатки, участвующие во взаимодействиях между вирусом (VP1: синий, VP3: красный) и 5G3, показаны в виде палочек, а гидрофобные взаимодействия показаны в виде поверхности и окрашены в серый цвет. Водородные связи отмечены желтыми штрихами. j Конфликт между 5G3 и двумя рецепторами E3, CD55 (слева) / FcRn (справа).Пентамер, легкая цепь 5G3, тяжелая цепь 5G3, рецептор CD55 и рецептор FcRn окрашены в серый, голубой, синий, пурпурный и желтый цвета соответственно.

Филогенетическое дерево на основе структуры, построенное из биологических протомеров, указывает на четыре основные подгруппы внутри HEV-B, среди которых E3 вместе с E6 и E30 составляют одну подгруппу, лежащую почти на равном расстоянии от CVB, E18 и подгрупп, репрезентативных CVA9 ( Рис. 1б). Хотя общие структуры этих HEV-B похожи друг на друга, основные структурные особенности, различающие подгруппы, лежат на плато (также называемых «мезой»), окружающих оси пяти частей (рис.1б). По сравнению с репрезентативными HEV-B из трех других подгрупп, E3 демонстрирует плотные «пятиугольные» выступы, тогда как CVB и CVA9 несут пять заметных спиралевидных и пять прерывистых выступов, соответственно (Рис. 1c). Интересно, что E18 заметно меньше диаметра 314 Å, что радикально отличается от диаметра других HEV-B (~ 325 Å) (рис. 1c). Эти структурные вариации возникают из-за измененных конформаций нескольких петель, расположенных на осях пятого порядка, таких как петли VP1 BC, DE и HI (рис.1г). Ряд ключевых структурных элементов, включая VP1 BC, петли DE и C-конец, петлю VP2 EF и VP3 EF, петли GH, вносят вклад в серотип-специфические антигенные сайты и создают «каньон», где часто встречается множество рецепторов HEV. bind (Рис. 1c, d; Дополнительный Рис. S4) 1,3 . Примечательно, что C-конец VP1, который, по-видимому, является наиболее дивергентным по последовательности среди четырех подгрупп HEV-B (дополнительный рисунок S4), в значительной степени неупорядочен в структурах нативного вируса (F-, EC- и EE-частицы) , что указывает на скрытый иммуногенный сайт, похожий на петлю VP1 GH в вирусе ящура (ящур) 9 .

Чтобы выяснить иммуногенные характеристики F-частиц E3, иммунизируя мышей, были получены шестнадцать моноклональных антител. Из них тот, названный 5G3, демонстрировал прочное связывание с E3 с K D 0,25 нМ, как определено поверхностным плазмонным резонансом (SPR) и мощной нейтрализующей активностью против E3 (значение нейтрализующей концентрации 50% (Neut 50 ). ~ 0.3 нМ) (рис. 1д, е). Чтобы расшифровать настоящие эпитопы на E3, нацеленные на 5G3, мы определили крио-ЭМ-структуры 5G3 в комплексе с E3 F- и EE-частицами в 3.9 Å и 4,1 Å соответственно (рис. 1g; дополнительные рис. S2b, c и S3d, e и таблица S2). Общие структуры двух иммунных комплексов обнаруживают идентичный эпитоп и характер связывания. Структура с более высоким разрешением E3 F-Particle-5G3 была использована для детального анализа взаимодействий вирус-антитело. 5G3 связывается с вирусной поверхностью по краям пентамерных строительных блоков вируса, прилегающих к двукратным осям, в положении, аналогичном тому, которое наблюдается для антитела R10, связанного с вирусом гепатита А (рис.1ч) 10 . Вариабельные домены легкой цепи и тяжелой цепи вносят вклад в ~ 64,2% и ~ 35,8% белок-белковых взаимодействий, соответственно, причем легкая цепь преимущественно связывает VP1 (Fig. 1i). Паратоп 5G3 включает три комплементарных определяющих участка (CDR): L1 (остатки 31–33), L3 (остатки 98 и 100) и h3 (остатки 51 и 54). Эпитоп 5G3 содержит остатки 283–287 и 292 на С-конце VP1, а также остатки 140 и 143 на VP3. Неупорядоченный в структуре апо, С-конец VP1 (остатки 275–292) в сложной структуре, однако, вставляется в высокогидрофобную щель, созданную LCDR1, LCDR3 и HCDR2 (рис.1i, верхняя левая панель и верхняя правая панель). Эти гидрофобные взаимодействия, таким образом, доминируют в распознавании вируса и антитела, и этому прочному связыванию дополнительно способствует ряд водородных связей (рис. 1i, нижняя левая панель и нижняя правая панель). Примечательно, что ни один из остатков, составляющих эпитопы, не является консервативным (0/7) для HEV-B (дополнительные фиг. S4 и S6), что позволяет предположить, что 5G3 является серотип-специфическим нейтрализующим антителом. Как и многие другие HEV-B, E3 использует CD55 для прикрепления вируса и FcRn для удаления оболочки вируса, обеспечивая эффективное проникновение в клетки-хозяева 11 .Чтобы проанализировать механизм нейтрализации 5G3, мы создали след этого антитела на поверхности E3 и обнаружили, что он не перекрывается с сайтами связывания вирусных рецепторов (CD55 и FcRn) (дополнительный рисунок S7). Однако наложение структур E30-FcRn (PDB: 7C9V) или E30-CD55 (PDB: 7C9W) на E3-5G3 выявило стерические конфликты между двумя рецепторами и 5G3 (Fig. 1j). Следовательно, 5G3 может эффективно нейтрализовать инфекцию E3, блокируя взаимодействия с двумя его рецепторами.

Таким образом, атомные структуры зрелого вириона E3 и двух типов пустых частиц выявляют специфические для серотипа структурные особенности между подгруппами внутри HEV-B и подчеркивают потенциал E3 F- или EC-частиц как идеальных кандидатов в вакцины. Иммуногенные характеристики и истинные эпитопы, определяемые первым E3-нейтрализующим антителом 5G3, лежат в основе иммуногенных различий в EV-B, что дает информацию о стратегиях разработки вакцин и терапевтических средств против этого эховируса, ассоциированного с антибактериальным гепатитом.

Доступность данных

Координаты атомов E3 F-, EC- и EE-частиц, а также комплексов E3 (F-частица) -, E3 (EE-частица) -5G3 были отправлены в банк данных по белкам под номерами доступа: 7C9X, 7EAI , 7EAH, 7EAK и 7EAJ соответственно. Соответствующие им крио-ЭМ карты были депонированы в банке данных электронной микроскопии под кодами доступа: EMD-30320, EMD-31044, EMD-31043, EMD-31046 и EMD-31045 соответственно.Все остальные материалы и данные, задействованные в этом исследовании, будут доступны по запросу.

Ссылки

  1. 1.

    Wang, X. et al. Сенсор-адаптер для снятия оболочки энтеровируса с структур EV71. Nat. Struct. Мол. Биол. 19 , 424–429 (2012).

    CAS Статья Google ученый

  2. 2.

    Leggiadro, R.J., Chwatsky, D. N. & Zucker, S. W. Инфекция эховируса 3, связанная с безжелтушным гепатитом. Am. J. Dis. Ребенок. 136 , 744–745 (1982).

    CAS PubMed Google ученый

  3. 3.

    Wang, K. et al. Структуры Echovirus 30 в комплексе с его рецепторами дают основание для рационального прогноза использования рецепторов энтеровирусов. Nat. Commun. 11 , 4421 (2020).

    CAS Статья Google ученый

  4. 4.

    Чжу, Л.и другие. Структуры вируса Коксаки А10 раскрывают молекулярные механизмы связывания рецепторов и распаковки вируса. Nat. Commun. 9 , 4985 (2018).

    Артикул Google ученый

  5. 5.

    Zhu, L. et al. Структура вируса Aichi человека и значение для связывания рецепторов. Nat. Microbiol. 1 , 16150 (2016).

    CAS Статья Google ученый

  6. 6.

    Wang, K. et al. Серотипоспецифические эпитопы, идентифицированные нейтрализующими антителами, лежат в основе иммуногенных различий энтеровируса B. Nat. Commun. 11 , 4419 (2020).

    CAS Статья Google ученый

  7. 7.

    Wang, X. et al. Вирус гепатита А и происхождение пикорнавирусов. Природа 517 , 85–88 (2015).

    CAS Статья Google ученый

  8. 8.

    Zhu, L. et al. Структура вируса Льюнгана дает представление об упаковке генома этого пикорнавируса. Nat. Commun. 6 , 8316 (2015).

    CAS Статья Google ученый

  9. 9.

    Hu, D. et al. Структурная и молекулярная основа нейтрализации вируса ящура двумя мощными защитными антителами. Protein Cell https://doi.org/10.1007/s13238-021-00828-9 (2020).

  10. 10.

    Wang, X. et al. Сильная нейтрализация вируса гепатита А выявляет механизм имитации рецептора и сайт узнавания рецептора. Proc. Natl Acad. Sci. США 114 , 770–775 (2017).

    CAS Статья Google ученый

  11. 11.

    Zhao, X. et al. Неонатальный Fc-рецептор человека является клеточным рецептором без оболочки для энтеровируса B. Cell 177 , 1553–1565.e16 (2019).

    CAS Статья Google ученый

Скачать ссылки

Благодарности

Мы благодарим Б.Zhu, X. Huang, X. Li и G. Ji за сбор крио-EM данных в Центре биологической визуализации (CBI) Института биофизики. Мы также благодарим Y. Chen, Z. Yang и B. Zhou за техническую поддержку SPR и X. Yu за техническое руководство AUC. Эта работа была поддержана Программой стратегических приоритетных исследований (XDB2

00 и XDB37030201), Пекинским фондом естественных наук и объединенным фондом примитивных инноваций Хайдянь (L192008), ключевыми программами Китайской академии (KJZD-SW-L05), Национальной ключевой программой исследований и разработок. (2018YFA01 и 2017YFC0840300), Национальный научный фонд Китая (31800145, 31941011, 31

3 и 81520108019) и Центр биобезопасности Mega-Science, CAS и проект исследований и разработок прикладных технологий провинции Хэйлунцзян (GA19B301).Лин Чжу получил поддержку Молодежной ассоциации содействия инновациям Китайской академии наук (2019098).

Информация об авторе

Заметки автора
  1. Эти авторы внесли одинаковый вклад: Руи Фенг, Лей Ван, Давэй Ши

Принадлежности

  1. Ключевая лаборатория инфекций и иммунитета CAS, Центр передового опыта в биомакромолекулах CAS , Китайская академия наук, Пекин, 100101, Китай

    Руи Фэн, Лей Ван, Сянси Ван, Кан Ван и Лин Чжу

  2. Университет Китайской академии наук, Пекин, 100049, Китай

    Руи Фэн, Лей Ван & Xiangxi Wang

  3. Институт контроля диагностики in vitro, Национальные институты по контролю за продуктами питания и лекарствами, Пекин, 100050, Китай

    Давэй Ши, Дэцзю Ся и Сихонг Сюй

  4. Национальная комиссия здравоохранения Китайской Народной Республики , Ключевая лаборатория кишечной патогенной микробиологии (Провинциальный центр по контролю и профилактике заболеваний Цзянсу), Нанкин, 210009, Цзянсу, Чи na

    Биньян Чжэн, Ли Чжан и Лунбиао Цуй

  5. Институт медицинских исследований Северо-Западного политехнического университета, Сиань, 710072, Шэньси, Китай

    Хай Хоу

Вклад

р.F., L.W., K.W., D.S. и B.Z. проводил эксперименты. К.В. и Л. решил структуру, L.Z., L.C., D.X. и H.H. предоставили реагенты. L.Z., K.W., S.X. и X.W. разработал исследование. Все авторы проанализировали данные. L.Z., X.W. и K.W. написал газету.

Авторы, ответственные за переписку

Переписка на Сянси Ван или Сихонг Сюй, или Кан Ван, или Лин Чжу.

Этические декларации

Конфликт интересов

Авторы заявляют об отсутствии конкурирующих интересов.

Дополнительная информация

Примечание издателя Springer Nature сохраняет нейтралитет в отношении юрисдикционных претензий на опубликованных картах и ​​сведений об учреждениях.

Дополнительная информация

Права и разрешения

Открытый доступ Эта статья находится под лицензией Creative Commons Attribution 4.0 International License, которая разрешает использование, совместное использование, адаптацию, распространение и воспроизведение на любом носителе или в любом формате, при условии, что вы укажете соответствующую ссылку на оригинального автора (авторов) и источник, укажите ссылку на лицензию Creative Commons и укажите, были ли внесены изменения.Изображения или другие материалы третьих лиц в этой статье включены в лицензию Creative Commons для статьи, если иное не указано в кредитной линии для материала. Если материал не включен в лицензию Creative Commons для статьи и ваше предполагаемое использование не разрешено законодательными актами или превышает разрешенное использование, вам необходимо получить разрешение непосредственно от правообладателя. Чтобы просмотреть копию этой лицензии, посетите http://creativecommons.org/licenses/by/4.0/.

Перепечатки и разрешения

Об этой статье

Цитируйте эту статью

Feng, R., Ван, Л., Ши, Д. и др. Структурная основа нейтрализации эховируса, ассоциированного с противоклеточным гепатитом, с помощью мощного нейтрализующего антитела. Cell Discov 7, 35 (2021). https://doi.org/10.1038/s41421-021-00264-3

Скачать цитату

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *